Mucopolysaccharidoses Types I-VII 

  • Author: Janette Baloghova, MD, PhD; Chief Editor: Dirk M Elston, MD   more...
 
Updated: Oct 10, 2011
 

Background

Mucopolysaccharidoses (MPSs) are a group of lysosomal storage diseases, each of which is produced by an inherited deficiency of an enzyme involved in the degradation of acid mucopolysaccharides, now called glycosaminoglycans (GAGs). These diseases are autosomal recessive, except for mucopolysaccharidosis type II, which is X-linked.

In addition to the Medscape Reference orthopedics article Mucopolysaccharidosis, the following are pediatrics articles on mucopolysaccharidoses:

Next

Pathophysiology

GAGs are long, linear polysaccharide molecules composed of repeating dimers, each of which contains a hexuronic acid (or galactose in the case of keratan sulfate) and an amino sugar. The large proteoglycan molecules made up of protein cores, and GAG branches are secreted by cells and constitute a significant fraction of the extracellular matrix of connective tissue. The turnover of these molecules depends on their subsequent internalization by endocytosis, their delivery to the lysosomes, and their digestion by lysosomal enzymes. The enzyme deficiencies lead to the accumulation of mucopolysaccharides in the lysosomes of the cells in the connective tissue and to an increase in their excretion in the urine. The types of mucopolysaccharidoses linked to specific enzyme deficiencies are listed below; some have been assigned an Enzyme Commission (EC) number.

Table. Types of Mucopolysaccharidoses and Associated Enzyme Deficiencies (Open Table in a new window)

Mucopolysaccharidosis Type Syndrome NameDeficiencyEC Number
MPS type I-HHurler syndromeAlpha-L-iduronidase3.2.1.76
MPS type I-S



(formerly MPS type V)



Scheie syndromeAlpha-L-iduronidaseN/A
MPS type I-H/SHurler-Scheie syndromeAlpha-L-iduronidaseN/A
MPS type II, mildHunter syndrome, mild formL-sulfoiduronate sulfataseN/A
MPS type II, severeHunter syndrome, severe formL-sulfoiduronate sulfatase3.1.6.13
MPS type III-ASanfilippo syndrome type AHeparan sulfate sulfamidase3.1.6.14
MPS type III-BSanfilippo syndrome type BN -acetyl-alpha-D-glucosaminidase3.2.1.50
MPS type III-CSanfilippo syndrome type CAcetyl-coenzyme A (CoA): alpha-glucosamide N -acetyltransferase2.3.1.3
MPS type III-DSanfilippo syndrome type DN -acetyl-alpha-D-glucosamine-6-sulfatase3.1.6.14
MPS type IV-AMorquio syndrome, classic formN -acetylgalactosamine-6-sulfatase (gal-6-sulfatase)3.1.6.4
MPS type IV-BMorquiolike syndromeBeta-galactosidase3.2.1.23
MPS type VIMaroteaux-Lamy syndrome, mild formN -acetylgalactosamine-4-sulfatase (arylsulfatase B)N/A
MPS type VIMaroteaux-Lamy syndrome, severe formN -acetylgalactosamine-4-sulfatase (arylsulfatase B)3.1.6.1
MPS type VIISly syndromeBeta-glucuronidase3.2.1.31

The enzyme synthesis is controlled at the following gene loci:

  • 4p16.3 (Hurler syndrome, Scheie syndrome): The activity of alpha-L-iduronidase is decreased in Hurler syndrome and Scheie syndrome. However, Hurler syndrome is a severe form of the same heavy mucopolysaccharidosis, with affected children dying after several years, whereas Scheie disease has a mild clinical phenotype. In some populations, premature stop mutations represent roughly two thirds of the mutations that cause Hurler syndrome.
  • 12q14 (Sanfilippo syndrome): The diagnosis requires a specific lysosomal enzyme assay for glucosamine (N -acetyl)-6-sulfatase (GNS) activity. A homozygous nonsense mutation is found in exon 9 (1063C --> T), which predicts premature termination of translation (R355X). In addition, 2 common synonymous coding single-nucleotide polymorphisms are found and genotyped in samples from 4 ethnic groups.
  • 16q24.3 (Morquio syndrome): The deficiency of enzymes in Morquio syndrome type A or type B leads to the accumulation of keratan sulfate and chondroitin-6-sulfate in the connective tissue, the skeletal system, and the teeth.
  • 5q11-q13 (Maroteaux-Lamy syndrome)
  • Xq27.3-q28 (Hunter syndrome)

A new mutation has been reported, making a total of 15 different mutations that can cause premature stop codons in the alpha-L-iduronidase gene (IDUA), and the biochemistry of these mutations has been investigated. Natural stop codon read-through is dependent on the fidelity of the codon when evaluated at Q70X and W402X in CHO-K1 cells, but the 3 possible stop codons, TAA, TAG, and TGA, have different effects on mRNA stability, and this effect is context dependent.

In CHO-K1 cells expressing the Q70X and W402X mutations, the level of gentamicin-enhanced stop codon read-through is slightly less than the increment in activity caused by a lower-fidelity stop codon. In this system, gentamicin has more effect on read-through for the TAA and TGA stop codons compared with the TAG stop codon. In a mucopolysaccharidosis type I patient study, premature TGA stop codons were associated with a slightly attenuated clinical phenotype when compared with classic Hurler syndrome (eg, W402X/W402X and Q70X/Q70X genotypes with TAG stop codons). Natural read-through of premature stop codons is a potential explanation for the variable clinical phenotype in patients with mucopolysaccharidosis type I. Enhanced stop codon read-through is a potential treatment strategy for a large subgroup of patients with mucopolysaccharidosis type I.

In 25 Korean patients with Hunter syndrome, 20 mutations were identified, of which 13 mutations are novel: 6 small deletions (ie, 69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (ie, 21_22insG, 683_684insC), 2 terminations (ie, 529G>T, 637A>T), and 3 missense mutations (ie, 353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII restriction fragment length polymorphisms, 3 gene deletions were found. When the 20 mutations were depicted in a 3-dimensional model of iduronate 2 sulfatase protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas.

The candidate gene for mucopolysaccharidosis type IIIC has been localized to the pericentric region of chromosome 8 by linkage disequilibrium analysis.

Hamano et al[1] immunohistochemically examined the involvement of tauopathy/synucleinopathy, cell death, and oxidative damage in the brains of 3 cases each of mucopolysaccharidosis IIIB and mucopolysaccharidosis II and age-matched controls. In cases of mucopolysaccharidosis IIIB, the density of GABAergic interneurons in the cerebral cortex immunoreactive for calbindin-D28K and parvalbumin was markedly reduced compared with age-matched controls. The swollen neurons showed immunoreactivity for phosphorylated alpha-synuclein but not for phosphorylated tau protein or beta-amyloid protein; those in the cerebral cortex demonstrated nuclear immunoreactivity for TUNEL, single-stranded DNA and 8-OHdG. Neither lipid peroxidation nor protein glycation was marked in mucopolysaccharidosis cases. The expression levels of superoxide dismutases (Cu/ZnSOD and MnSOD) and glial glutamate transporters (EAAT1 and EAAT2) were reduced in 2 mucopolysaccharidosis II cases.

The disturbance of GABAergic interneurons can be related to mental disturbance, while synucleinopathy and/or DNA impairment may be implicated in the neurodegeneration of swelling neurons, owing to storage materials in mucopolysaccharidosis IIIB cases. These findings suggest the possibility of neuroprotective therapies other than enzyme replacement in mucopolysaccharidosis patients.[1]

The transmembrane protein gene TMEM76, which encodes a 73-kd protein with predicted multiple transmembrane domains and glycosylation sites, was found. Northern blot analysis identified 2 major TMEM76 transcripts of 4.5 kb and 2.1 kb ubiquitously expressed in various human tissues. The highest expression was detected in leukocytes and in heart, lung, placenta, and liver cells, whereas the gene was expressed at a much lower level in the thymus, colon, and brain, which is consistent with the expression patterns of lysosomal proteins. A total of 27 TMEM76 mutations were identified in the DNA of 30 mucopolysaccharidosis IIIC–affected families, which were not found in DNA from 105 controls.[2]

Functional expression of human TMEM76 and the mouse orthologue demonstrates that this gene encodes the lysosomal GNAT. Furthermore, it suggests that this enzyme belongs to a new structural class of proteins that transport the activated acetyl residues across the cell membrane.[2]

Previous
Next

Epidemiology

Frequency

International

  • The prevalences are as follows: mucopolysaccharidosis type I-H, 1-2 cases per 100,000 population; mucopolysaccharidosis type I-S, 1 case per 250,000 population; mucopolysaccharidosis type II, 1 case per 100,000 population; mucopolysaccharidosis type III, 1 case per 25,000-75,000 population; and mucopolysaccharidosis type IV, 1 case per 40,000-200,000 population.
  • The prevalences of mucopolysaccharidosis types VI, VII, and I-H/S are unknown, but the prevalence of mucopolysaccharidosis type I-H/S approximates that of mucopolysaccharidosis type I-S.
  • According to the US National Institutes of Health, studies in Canada estimate 1 in 100,000 babies born has Hurler syndrome. The estimate for Hurler-Scheie syndrome is 1 in 115,000, and for Scheie syndrome, it is 1 in 500,000.
  • An epidemiologic study of the mucopolysaccharidoses in Western Australia using multiple ascertainment sources was performed and the incidence rate for the period 1969-1996 was estimated. An incidence of approximately 1 case in 107,000 live births was obtained for mucopolysaccharidosis type I-H (Hurler phenotype); 1 case in 320,000 live births (1 in 165,000 male live births) for mucopolysaccharidosis type II (Hunter syndrome); 1 case in 58,000 for mucopolysaccharidosis III (Sanfilippo syndrome); 1 case in 640,000 for mucopolysaccharidosis type IV-A (Morquio syndrome type A); and 1 case in 320,000 for mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome). The overall incidence for all types of mucopolysaccharidosis was approximately 1 case in 29,000 live births.
  • Murphy et al estimated the incidence (2001-2006) and prevalence (2002 census) of mucopolysaccharidosis type I in the Irish Republic (AOl) using population data. The birth incidence was 1 case in 26,206 births, with a carrier frequency of 1 case in 81 births. Of note, 19 (73%) of 26 Hurler syndrome patients were Irish Travelers. Amongst Irish Travelers, the incidence was 1 case in 371 persons, with a carrier frequency of 1 case in 10 persons. This is the highest recorded incidence worldwide.[3]
  • According to the incidence study covered the period from 1975-2004 in Sweden and Denmark and from 1979-2004 in Norway, the incidence of all mucopolysaccharidosis disorders was 1.75 cases in Sweden, 3.08 cases in Norway, and 1.77 cases in Denmark per 100 000 newborns. The incidence of mucopolysaccharidosis type I was the most common in all 3 countries, with 0.67, 1.85, and 0.54 cases per 100 000 newborns, respectively; for mucopolysaccharidosis type II, numbers were 0.27, 0.13, and 0.27 cases, respectively. For patients with other mucopolysaccharidosis disorders, the incidence varied widely. The prevalence for all mucopolysaccharidosis disorders was 4.24, 7.06, and 6.03 cases per million inhabitants in Sweden, Norway, and Denmark, respectively.[4]
  • Héron et al in the retrospective epidemiological study in France, the United Kingdom, and Greece calculated the incidence according to the number of patients born each year and then diagnosed with mucopolysaccharidosis type III before 2006. A comparison between countries focused on years 1990-1994. The calculated incidence of mucopolysaccharidosis type III in France (0.68 case per 100,000 live-births) was almost half that in the United Kingdom (1.15 cases per 100,000). Prevalence in Greece (0.97 case per 100,000 live-births) was in between France and the United Kingdom. However, mucopolysaccharidosis type IIIA was not diagnosed in Greece, and mucopolysaccharidosis type IIIB was the most highly prevalent type.[5]

Mortality/Morbidity

Patients with Hurler syndrome usually die by age 5-10 years. The life expectancy of patients with Scheie syndrome may be nearly normal. They can live until the fifth or sixth decade of life, and they can have healthy offspring. As for patients with Hunter and Sanfilippo syndromes, death usually occurs by the time of puberty. In the classic form of Morquio syndrome, long-term survival is rare, with death occurring in persons aged 20-40 years. In patients with the severe form of Maroteaux-Lamy syndrome, death usually occurs by early adulthood.

Age

Onset usually occurs in early childhood.

Previous
Proceed to Clinical Presentation
 
 
Contributor Information and Disclosures
Author

Janette Baloghova, MD, PhD  Lecturer, Medical Faculty, University of PJ Safarik; Dermatovenerologist, Faculty Hospital of L Pasteur, Slovak Republic

Disclosure: Nothing to disclose.

Coauthor(s)

Robert A Schwartz, MD, MPH  Professor and Head, Dermatology, Professor of Pathology, Pediatrics, Medicine, and Preventive Medicine and Community Health, University of Medicine and Dentistry of New Jersey-New Jersey Medical School

Robert A Schwartz, MD, MPH is a member of the following medical societies: Alpha Omega Alpha, American Academy of Dermatology, American College of Physicians, and Sigma Xi

Disclosure: Nothing to disclose.

Zuzana Baranova, MD, PhD  Senior Lecturer, Department of Dermatology, University of PJ Safarik at Kosice, Slovak Republic

Disclosure: Nothing to disclose.

Specialty Editor Board

Jacek C Szepietowski, MD, PhD  Professor, Vice-Head, Department of Dermatology, Venereology and Allergology, Wroclaw Medical University; Director of the Institute of Immunology and Experimental Therapy, Polish Academy of Sciences, Poland

Disclosure: Stiefel GSK Company Salary Employment; Orfagen Consulting fee Consulting; Maruho Consulting fee Consulting; Astellas Consulting fee Consulting; Abbott Consulting fee Consulting; Leo Pharma Consulting fee Consulting

David F Butler, MD  Professor of Dermatology, Texas A&M University College of Medicine; Chair, Department of Dermatology, Director, Dermatology Residency Training Program, Scott and White Clinic, Northside Clinic

David F Butler, MD is a member of the following medical societies: Alpha Omega Alpha, American Academy of Dermatology, American Medical Association, American Society for Dermatologic Surgery, American Society for MOHS Surgery, Association of Military Dermatologists, and Phi Beta Kappa

Disclosure: Nothing to disclose.

Jeffrey J Miller, MD  Associate Professor of Dermatology, Pennsylvania State University College of Medicine; Staff Dermatologist, Pennsylvania State Milton S Hershey Medical Center

Jeffrey J Miller, MD is a member of the following medical societies: Alpha Omega Alpha, American Academy of Dermatology, Association of Professors of Dermatology, North American Hair Research Society, and Society for Investigative Dermatology

Disclosure: Nothing to disclose.

Catherine M Quirk, MD  Clinical Assistant Professor, Department of Dermatology, University of Pennsylvania

Catherine M Quirk, MD is a member of the following medical societies: Alpha Omega Alpha and American Academy of Dermatology

Disclosure: Nothing to disclose.

Chief Editor

Dirk M Elston, MD  Director, Ackerman Academy of Dermatopathology, New York

Dirk M Elston, MD is a member of the following medical societies: American Academy of Dermatology

Disclosure: Nothing to disclose.

Additional Contributors

The authors and editors of Medscape Reference gratefully acknowledge the contributions of previous author, Alexander Halagovec, MD, PhD, to the development and writing of this article.

References

  1. Hamano K, Hayashi M, Shioda K, Fukatsu R, Mizutani S. Mechanisms of neurodegeneration in mucopolysaccharidoses II and IIIB: analysis of human brain tissue. Acta Neuropathol. May 2008;115(5):547-59. [Medline].

  2. Hrebicek M, Mrazova L, Seyrantepe V, et al. Mutations in TMEM76* cause mucopolysaccharidosis IIIC (Sanfilippo C syndrome). Am J Hum Genet. Nov 2006;79(5):807-19. [Medline].

  3. Murphy AM, Lambert D, Treacy EP, O'Meara A, Lynch SA. Incidence and prevalence of mucopolysaccharidosis type 1 in the Irish republic. Arch Dis Child. Jan 2009;94(1):52-4. [Medline].

  4. Malm G, Lund AM, Mansson JE, Heiberg A. Mucopolysaccharidoses in the Scandinavian countries: incidence and prevalence. Acta Paediatr. Nov 2008;97(11):1577-81. [Medline].

  5. Héron B, Mikaeloff Y, Froissart R, et al. Incidence and natural history of mucopolysaccharidosis type III in France and comparison with United Kingdom and Greece. Am J Med Genet A. Jan 2011;155A(1):58-68. [Medline].

  6. Ashrafi MR, Shabanian R, Mohammadi M, Kavusi S. Extensive Mongolian spots: a clinical sign merits special attention. Pediatr Neurol. Feb 2006;34(2):143-5. [Medline].

  7. Panteliadis CP, Karatza ED, Tzitiridou MK, Koliouskas DE, Spiroglou KS. Lissencephaly and mongolian spots in Hurler syndrome. Pediatr Neurol. Jul 2003;29(1):59-62. [Medline].

  8. Nemes A, Timmermans RG, Wilson JH, et al. The mild form of mucopolysaccharidosis type I (Scheie syndrome) is associated with increased ascending aortic stiffness. Heart Vessels. Mar 2008;23(2):108-11. [Medline].

  9. Demitsu T, Kakurai M, Okubo Y, et al. Skin eruption as the presenting sign of Hunter syndrome IIB. Clin Exp Dermatol. May 1999;24(3):179-82. [Medline].

  10. Sapadin AN, Friedman IS. Extensive Mongolian spots associated with Hunter syndrome. J Am Acad Dermatol. Dec 1998;39(6):1013-5. [Medline].

  11. Ochiai T, Suzuki Y, Kato T, et al. Natural history of extensive Mongolian spots in mucopolysaccharidosis type II (Hunter syndrome): a survey among 52 Japanese patients. J Eur Acad Dermatol Venereol. Sep 2007;21(8):1082-5. [Medline].

  12. Schwartz I, Vedolin L, Jardim LB, et al. Brain magnetic resonance imaging and spectroscopic findings inmucopolysaccharidosis type II. Acta Paediatrica. 2007;96:109-11.

  13. Kwon JY, Ko K, Sohn YB, et al. High prevalence of carpal tunnel syndrome in children with mucopolysaccharidosis type II (Hunter syndrome). Am J Med Genet A. Jun 2011;155A(6):1329-35. [Medline].

  14. Meyer A, Kossow K, Gal A, et al. Scoring evaluation of the natural course of mucopolysaccharidosis type IIIA (Sanfilippo syndrome type A). Pediatrics. Nov 2007;120(5):e1255-61. [Medline].

  15. Valayannopoulos V, Nicely H, Harmatz P, Turbeville S. Mucopolysaccharidosis VI. Orphanet J Rare Dis. Apr 12 2010;5:5. [Medline]. [Full Text].

  16. Alpoz AR, Coker M, Celen E, et al. The oral manifestations of Maroteaux-Lamy syndrome (mucopolysaccharidosis VI): a case report. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. May 2006;101(5):632-7. [Medline].

  17. Oudit GY, Butany J, Williams WG, Siu SC, Clarke JT, Iwanochko RM. Left ventricular aneurysm in a patient with mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome): clinical and pathological correlation. Cardiovasc Pathol. Jul-Aug 2007;16(4):237-40. [Medline].

  18. Dickerman RD, Colle KO, Bruno CA Jr, Schneider SJ. Craniovertebral instability with spinal cord compression in a 17-month-old boy with Sly syndrome (mucopolysaccharidosis type VII): a surgical dilemma. Spine. Mar 1 2004;29(5):E92-4. [Medline].

  19. Venkat-Raman N, Sebire NJ, Murphy KW. Recurrent fetal hydrops due to mucopolysaccharidoses type VII. Fetal Diagn Ther. 2006;21(3):250-4. [Medline].

  20. Delbecque K, Gaillez S, Schaaps JP. Histopathological diagnosis of a type vii mucopolysaccharidosis after pregnancy termination. Fetal Pediatr Pathol. 2009;28(1):1-8. [Medline].

  21. Ashworth JL, Kruse FE, Bachmann B, et al. Ocular manifestations in the mucopolysaccharidoses – a review. Clin Exp Ophthalmol. 2010;38:12–22.

  22. Gallegos-Arreola MP, Machorro-Lazo MV, Flores-Martinez SE, et al. Urinary glycosaminoglycan excretion in healthy subjects and in patients with mucopolysaccharidoses. Arch Med Res. Sep-Oct 2000;31(5):505-10. [Medline].

  23. Dean CJ, Bockmann MR, Hopwood JJ, Brooks DA, Meikle PJ. Detection of mucopolysaccharidosis type II by measurement of iduronate-2-sulfatase in dried blood spots and plasma samples. Clin Chem. Apr 2006;52(4):643-9. [Medline].

  24. Gabrielli O, Polonara G, Regnicolo L, et al. Correlation between cerebral MRI abnormalities and mental retardation in patients with mucopolysaccharidoses. Am J Med Genet A. Mar 15 2004;125A(3):224-31. [Medline].

  25. Matheus MG, Castillo M, Smith JK, Armao D, Towle D, Muenzer J. Brain MRI findings in patients with mucopolysaccharidosis types I and II and mild clinical presentation. Neuroradiology. Aug 2004;46(8):666-72. [Medline].

  26. Di Natale P, Villani GR, Parini R, et al. Molecular markers for the follow-up of enzyme-replacement therapy in mucopolysaccharidosis type VI disease. Biotechnol Appl Biochem. Mar 2008;49:219-23. [Medline].

  27. Husain AM, Escolar ML, Kurtzberg J. Neurophysiologic assessment of mucopolysaccharidosis III. Clin Neurophysiol. Sep 2006;117(9):2059-63. [Medline].

  28. Cimaz R, Vijay S, Haase C, et al. Attenuated type I mucopolysaccharidosis in the differential diagnosis of juvenile idiopathic arthritis: a series of 13 patients with Scheie syndrome. Clin Exp Rheumatol. Mar-Apr 2006;24(2):196-202. [Medline].

  29. Anawis MA. Hunter syndrome (MPS II-B): a report of bilateral vitreous floaters and maculopathy. Ophthalmic Genet. Jun 2006;27(2):71-2. [Medline].

  30. Blanchard S, Sadilek M, Scott CR, Turecek F, Gelb MH. Tandem mass spectrometry for the direct assay of lysosomal enzymes in dried blood spots: application to screening newborns for mucopolysaccharidosis I. Clin Chem. Dec 2008;54(12):2067-70. [Medline].

  31. Randall DR, Colobong KE, Hemmelgarn H, et al. Heparin cofactor II-thrombin complex: a biomarker of MPS disease. Mol Genet Metab. Aug 2008;94(4):456-61. [Medline].

  32. Braunlin EA, Berry JM, Whitley CB. Cardiac findings after enzyme replacement therapy for mucopolysaccharidosis type I. Am J Cardiol. Aug 1 2006;98(3):416-8. [Medline].

  33. Gassas A, Sung L, Doyle JJ, Clarke JT, Saunders EF. Life-threatening pulmonary hemorrhages post bone marrow transplantation in Hurler syndrome. Report of three cases and review of the literature. Bone Marrow Transplant. Jul 2003;32(2):213-5. [Medline].

  34. Grewal SS, Krivit W, Defor TE, et al. Outcome of second hematopoietic cell transplantation in Hurler syndrome. Bone Marrow Transplant. Mar 2002;29(6):491-6. [Medline].

  35. Harmatz P, Whitley CB, Waber L, et al. Enzyme replacement therapy in mucopolysaccharidosis VI (Maroteaux-Lamy syndrome). J Pediatr. May 2004;144(5):574-80. [Medline].

  36. Kloska A, Jakóbkiewicz-Banecka J, Narajczyk M, Banecka-Majkutewicz Z, Wegrzyn G. Effects of flavonoids on glycosaminoglycan synthesis: implications for substrate reduction therapy in Sanfilippo disease and other mucopolysaccharidoses. Metab Brain Dis. Mar 2011;26(1):1-8. [Medline]. [Full Text].

  37. Muenzer J, Wraith JE, Beck M, et al. A phase II/III clinical study of enzyme replacement therapy with idursulfase in mucopolysaccharidosis II (Hunter syndrome). Genet Med. Aug 2006;8(8):465-73. [Medline].

  38. Wraith JE, Clarke LA, Beck M, et al. Enzyme replacement therapy for mucopolysaccharidosis I: a randomized, double-blinded, placebo-controlled, multinational study of recombinant human alpha-L-iduronidase (laronidase). J Pediatr. May 2004;144(5):581-8. [Medline].

  39. Muenzer J, Wraith JE, Clarke LA. Mucopolysaccharidosis I: management and treatment guidelines. Pediatrics. Jan 2009;123(1):19-29. [Medline].

  40. Harmatz P, Giugliani R, Schwartz I, et al. Enzyme replacement therapy for mucopolysaccharidosis VI: a phase 3, randomized, double-blind, placebo-controlled, multinational study of recombinant human N-acetylgalactosamine 4-sulfatase (recombinant human arylsulfatase B or rhASB) and follow-on, open-label extension study. J Pediatr. Apr 2006;148(4):533-539. [Medline].

  41. Hein LK, Bawden M, Muller VJ, Sillence D, Hopwood JJ, Brooks DA. alpha-L-iduronidase premature stop codons and potential read-through in mucopolysaccharidosis type I patients. J Mol Biol. Apr 30 2004;338(3):453-62. [Medline].

  42. Altarescu G, Renbaum P, Eldar-Geva T, et al. Preventing mucopolysaccharidosis type II (Hunter syndrome): PGD and establishing a Hunter (46, XX) stem cell line. Prenat Diagn. Jun 27 2011;[Medline].

  43. Caillaud C, Poenaru L. Gene therapy in lysosomal diseases. Biomed Pharmacother. Oct 2000;54(10):505-12. [Medline].

  44. Fu H, Samulski RJ, McCown TJ, Picornell YJ, Fletcher D, Muenzer J. Neurological correction of lysosomal storage in a mucopolysaccharidosis IIIB mouse model by adeno-associated virus-mediated gene delivery. Mol Ther. Jan 2002;5(1):42-9. [Medline].

  45. Gosele S, Dithmar S, Holz FG, Volcker HE. [Late diagnosis of Morquio syndrome. Clinical histopathological findings in a rare mucopolysaccharidosis]. Klin Monatsbl Augenheilkd. Aug 2000;217(2):114-7. [Medline].

  46. Ito K, Ochiai T, Suzuki H, Chin M, Shichino H, Mugishima H. The effect of haematopoietic stem cell transplant on papules with 'pebbly' appearance in Hunter's syndrome. Br J Dermatol. Jul 2004;151(1):207-11. [Medline].

  47. Jeong HS, Cho DY, Ahn KM, Jin DK. Complications of tracheotomy in patients with mucopolysaccharidoses type II (Hunter syndrome). Int J Pediatr Otorhinolaryngol. Oct 2006;70(10):1765-9. [Medline].

  48. Kakavanos R, Turner CT, Hopwood JJ, Kakkis ED, Brooks DA. Immune tolerance after long-term enzyme-replacement therapy among patients who have mucopolysaccharidosis I. Lancet. May 10 2003;361(9369):1608-13. [Medline].

  49. Kakkis ED, Muenzer J, Tiller GE, et al. Enzyme-replacement therapy in mucopolysaccharidosis I. N Engl J Med. Jan 18 2001;344(3):182-8. [Medline].

  50. Keeling KM, Brooks DA, Hopwood JJ, Li P, Thompson JN, Bedwell DM. Gentamicin-mediated suppression of Hurler syndrome stop mutations restores a low level of alpha-L-iduronidase activity and reduces lysosomal glycosaminoglycan accumulation. Hum Mol Genet. Feb 1 2001;10(3):291-9. [Medline].

  51. Kim CH, Hwang HZ, Song SM, et al. Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations. Hum Mutat. Apr 2003;21(4):449-50. [Medline].

  52. Krivit W. Allogeneic stem cell transplantation for the treatment of lysosomal and peroxisomal metabolic diseases. Springer Semin Immunopathol. Nov 2004;26(1-2):119-32. [Medline].

  53. Lee V, Li CK, Shing MM, et al. Umbilical cord blood transplantation for Maroteaux-Lamy syndrome (mucopolysaccharidosis type VI). Bone Marrow Transplant. Aug 2000;26(4):455-8. [Medline].

  54. Leighton SE, Papsin B, Vellodi A, Dinwiddie R, Lane R. Disordered breathing during sleep in patients with mucopolysaccharidoses. Int J Pediatr Otorhinolaryngol. Apr 27 2001;58(2):127-38. [Medline].

  55. Mahalingam K, Janani S, Priya S, Elango EM, Sundari RM. Diagnosis of mucopolysaccharidoses: how to avoid false positives and false negatives. Indian J Pediatr. Jan 2004;71(1):29-32. [Medline].

  56. Mariotti P, Della Marca G, Iuvone L, et al. Sleep disorders in Sanfilippo syndrome: a polygraphic study. Clin Electroencephalogr. Jan 2003;34(1):18-22. [Medline].

  57. Mok A, Cao H, Hegele RA. Genomic basis of mucopolysaccharidosis type IIID (MIM 252940) revealed by sequencing of GNS encoding N-acetylglucosamine-6-sulfatase. Genomics. Jan 2003;81(1):1-5. [Medline].

  58. Nelson J, Crowhurst J, Carey B, Greed L. Incidence of the mucopolysaccharidoses in Western Australia. Am J Med Genet A. Dec 15 2003;123A(3):310-3. [Medline].

  59. Prystowsky SD, Maumenee IH, Freeman RG, Herndon JH Jr, Harrod MJ. A cutaneous marker in the Hunter syndrome a report of four cases. Arch Dermatol. May 1977;113(5):602-5. [Medline].

  60. Punnett A, Bliss B, Dupuis LL, Abdolell M, Doyle J, Sung L. Ototoxicity following pediatric hematopoietic stem cell transplantation: a prospective cohort study. Pediatr Blood Cancer. Jun 2004;42(7):598-603. [Medline].

  61. Rigante D, Caradonna P. Secondary skeletal involvement in Sanfilippo syndrome. QJM. Apr 2004;97(4):205-9. [Medline].

  62. Ross CJ, Bastedo L, Maier SA, Sands MS, Chang PL. Treatment of a lysosomal storage disease, mucopolysaccharidosis VII, with microencapsulated recombinant cells. Hum Gene Ther. Oct 10 2000;11(15):2117-27. [Medline].

  63. Sands MS, Barker JE, Vogler C, et al. Treatment of murine mucopolysaccharidosis type VII by syngeneic bone marrow transplantation in neonates. Lab Invest. Jun 1993;68(6):676-86. [Medline].

  64. Schiro JA, Mallory SB, Demmer L, Dowton SB, Luke MC. Grouped papules in Hurler-Scheie syndrome. J Am Acad Dermatol. Nov 1996;35(5 Pt 2):868-70. [Medline].

  65. Scriver RC, Beaudet AL, Sly WS. The Metabolic and Molecular Bases of Inherited Disease. New York, NY: McGraw-Hill; 1995.

  66. Seyrantepe V, Tihy F, Pshezhetsky AV. The microcell-mediated transfer of human chromosome 8 restores the deficient N-acetylytransferase activity in skin fibroblasts of Mucopolysaccharidosis type IIIC patients. Hum Genet. Sep 2006;120(2):293-6. [Medline].

  67. Shinhar SY, Zablocki H, Madgy DN. Airway management in mucopolysaccharide storage disorders. Arch Otolaryngol Head Neck Surg. Feb 2004;130(2):233-7. [Medline].

  68. Weisstein JS, Delgado E, Steinbach LS, Hart K, Packman S. Musculoskeletal manifestations of Hurler syndrome: long-term follow-up after bone marrow transplantation. J Pediatr Orthop. Jan-Feb 2004;24(1):97-101. [Medline].

  69. Whitley CB, Belani KG, Chang PN, et al. Long-term outcome of Hurler syndrome following bone marrow transplantation. Am J Med Genet. Apr 15 1993;46(2):209-18. [Medline].

  70. Wolanczyk T, Banaszkiewicz A, Mierzewska H, Czartoryska B, Zdziennicka E. [Hyperactivity and behavioral disorders in Sanfilippo A (mucopolysaccharidosis type IIIA)--case report and review of the literature]. Psychiatr Pol. Sep-Oct 2000;34(5):831-7. [Medline].

 
Previous
Next
 
Table. Types of Mucopolysaccharidoses and Associated Enzyme Deficiencies
Mucopolysaccharidosis Type Syndrome NameDeficiencyEC Number
MPS type I-HHurler syndromeAlpha-L-iduronidase3.2.1.76
MPS type I-S



(formerly MPS type V)



Scheie syndromeAlpha-L-iduronidaseN/A
MPS type I-H/SHurler-Scheie syndromeAlpha-L-iduronidaseN/A
MPS type II, mildHunter syndrome, mild formL-sulfoiduronate sulfataseN/A
MPS type II, severeHunter syndrome, severe formL-sulfoiduronate sulfatase3.1.6.13
MPS type III-ASanfilippo syndrome type AHeparan sulfate sulfamidase3.1.6.14
MPS type III-BSanfilippo syndrome type BN -acetyl-alpha-D-glucosaminidase3.2.1.50
MPS type III-CSanfilippo syndrome type CAcetyl-coenzyme A (CoA): alpha-glucosamide N -acetyltransferase2.3.1.3
MPS type III-DSanfilippo syndrome type DN -acetyl-alpha-D-glucosamine-6-sulfatase3.1.6.14
MPS type IV-AMorquio syndrome, classic formN -acetylgalactosamine-6-sulfatase (gal-6-sulfatase)3.1.6.4
MPS type IV-BMorquiolike syndromeBeta-galactosidase3.2.1.23
MPS type VIMaroteaux-Lamy syndrome, mild formN -acetylgalactosamine-4-sulfatase (arylsulfatase B)N/A
MPS type VIMaroteaux-Lamy syndrome, severe formN -acetylgalactosamine-4-sulfatase (arylsulfatase B)3.1.6.1
MPS type VIISly syndromeBeta-glucuronidase3.2.1.31
Previous
Next
 
 
 
 
 
All material on this website is protected by copyright, Copyright © 1994-2012 by WebMD LLC.
This website also contains material copyrighted by 3rd parties.

DISCLAIMER: The content of this Website is not influenced by sponsors. The site is designed primarily for use by qualified physicians and other medical professionals. The information contained herein should NOT be used as a substitute for the advice of an appropriately qualified and licensed physician or other health care provider. The information provided here is for educational and informational purposes only. In no way should it be considered as offering medical advice. Please check with a physician if you suspect you are ill.