eMedicine Specialties > Dermatology > Pediatric Diseases

Mucopolysaccharidoses Types I-VII

Author: Janette Baloghova, MD, PhD, Lecturer, Department of Dermatology, Medical Faculty, University of PJ Safarik at Kosice, Slovak Republic
Coauthor(s): Robert A Schwartz, MD, MPH, Professor and Head, Dermatology, Professor of Pathology, Pediatrics, Medicine, and Preventive Medicine and Community Health, UMDNJ-New Jersey Medical School; Zuzana Baranova, MD, PhD, Senior Lecturer, Department of Dermatology, University of PJ Safarik at Kosice, Slovak Republic
Contributor Information and Disclosures

Updated: May 21, 2009

Introduction

Background

Mucopolysaccharidoses (MPSs) are a group of lysosomal storage diseases, each of which is produced by an inherited deficiency of an enzyme involved in the degradation of acid mucopolysaccharides, now called glycosaminoglycans (GAGs). These diseases are autosomal recessive, except for mucopolysaccharidosis type II, which is X-linked.

In addition to the eMedicine orthopedics article Mucopolysaccharidosis, the following are eMedicine’s pediatrics articles on mucopolysaccharidoses:

Pathophysiology

GAGs are long, linear polysaccharide molecules composed of repeating dimers, each of which contains a hexuronic acid (or galactose in the case of keratan sulfate) and an amino sugar. The large proteoglycan molecules made up of protein cores, and GAG branches are secreted by cells and constitute a significant fraction of the extracellular matrix of connective tissue. The turnover of these molecules depends on their subsequent internalization by endocytosis, their delivery to the lysosomes, and their digestion by lysosomal enzymes. The enzyme deficiencies lead to the accumulation of mucopolysaccharides in the lysosomes of the cells in the connective tissue and to an increase in their excretion in the urine. The types of mucopolysaccharidoses linked to specific enzyme deficiencies are listed below; some have been assigned an Enzyme Commission (EC) number.

Types of Mucopolysaccharidoses and Associated Enzyme Deficiencies

Open table in new window

Table
Mucopolysaccharidosis Type Syndrome NameDeficiencyEC Number
MPS type I-HHurler syndromeAlpha-L-iduronidase3.2.1.76
MPS type I-S
(formerly MPS type V)
Scheie syndromeAlpha-L-iduronidaseN/A
MPS type I-H/SHurler-Scheie syndromeAlpha-L-iduronidaseN/A
MPS type II, mildHunter syndrome, mild formL-sulfoiduronate sulfataseN/A
MPS type II, severeHunter syndrome, severe formL-sulfoiduronate sulfatase3.1.6.13
MPS type III-ASanfilippo syndrome type AHeparan sulfate sulfamidase3.1.6.14
MPS type III-BSanfilippo syndrome type BN -acetyl-alpha-D-glucosaminidase3.2.1.50
MPS type III-CSanfilippo syndrome type CAcetyl-coenzyme A (CoA): alpha-glucosamide N -acetyltransferase2.3.1.3
MPS type III-DSanfilippo syndrome type DN -acetyl-alpha-D-glucosamine-6-sulfatase3.1.6.14
MPS type IV-AMorquio syndrome, classic formN -acetylgalactosamine-6-sulfatase (gal-6-sulfatase)3.1.6.4
MPS type IV-BMorquiolike syndromeBeta-galactosidase3.2.1.23
MPS type VIMaroteaux-Lamy syndrome, mild formN -acetylgalactosamine-4-sulfatase (arylsulfatase B)N/A
MPS type VIMaroteaux-Lamy syndrome, severe formN -acetylgalactosamine-4-sulfatase (arylsulfatase B)3.1.6.1
MPS type VIISly syndromeBeta-glucuronidase3.2.1.31
Mucopolysaccharidosis Type Syndrome NameDeficiencyEC Number
MPS type I-HHurler syndromeAlpha-L-iduronidase3.2.1.76
MPS type I-S
(formerly MPS type V)
Scheie syndromeAlpha-L-iduronidaseN/A
MPS type I-H/SHurler-Scheie syndromeAlpha-L-iduronidaseN/A
MPS type II, mildHunter syndrome, mild formL-sulfoiduronate sulfataseN/A
MPS type II, severeHunter syndrome, severe formL-sulfoiduronate sulfatase3.1.6.13
MPS type III-ASanfilippo syndrome type AHeparan sulfate sulfamidase3.1.6.14
MPS type III-BSanfilippo syndrome type BN -acetyl-alpha-D-glucosaminidase3.2.1.50
MPS type III-CSanfilippo syndrome type CAcetyl-coenzyme A (CoA): alpha-glucosamide N -acetyltransferase2.3.1.3
MPS type III-DSanfilippo syndrome type DN -acetyl-alpha-D-glucosamine-6-sulfatase3.1.6.14
MPS type IV-AMorquio syndrome, classic formN -acetylgalactosamine-6-sulfatase (gal-6-sulfatase)3.1.6.4
MPS type IV-BMorquiolike syndromeBeta-galactosidase3.2.1.23
MPS type VIMaroteaux-Lamy syndrome, mild formN -acetylgalactosamine-4-sulfatase (arylsulfatase B)N/A
MPS type VIMaroteaux-Lamy syndrome, severe formN -acetylgalactosamine-4-sulfatase (arylsulfatase B)3.1.6.1
MPS type VIISly syndromeBeta-glucuronidase3.2.1.31

The enzyme synthesis is controlled at the following gene loci:

  • 4p16.3 (Hurler syndrome, Scheie syndrome): The activity of alpha-L-iduronidase is decreased in Hurler syndrome and Scheie syndrome. However, Hurler syndrome is a severe form of the same heavy mucopolysaccharidosis, with affected children dying after several years, whereas Scheie disease has a mild clinical phenotype. In some populations, premature stop mutations represent roughly two thirds of the mutations that cause Hurler syndrome.
  • 12q14 (Sanfilippo syndrome): The diagnosis requires a specific lysosomal enzyme assay for glucosamine (N -acetyl)-6-sulfatase (GNS) activity. A homozygous nonsense mutation is found in exon 9 (1063C --> T), which predicts premature termination of translation (R355X). In addition, 2 common synonymous coding single-nucleotide polymorphisms are found and genotyped in samples from 4 ethnic groups.
  • 16q24.3 (Morquio syndrome): The deficiency of enzymes in Morquio syndrome type A or type B leads to the accumulation of keratan sulfate and chondroitin-6-sulfate in the connective tissue, the skeletal system, and the teeth.
  • 5q11-q13 (Maroteaux-Lamy syndrome)
  • Xq27.3-q28 (Hunter syndrome)

A new mutation has been reported, making a total of 15 different mutations that can cause premature stop codons in the alpha-L-iduronidase gene (IDUA), and the biochemistry of these mutations has been investigated. Natural stop codon read-through is dependent on the fidelity of the codon when evaluated at Q70X and W402X in CHO-K1 cells, but the 3 possible stop codons, TAA, TAG, and TGA, have different effects on mRNA stability, and this effect is context dependent.

In CHO-K1 cells expressing the Q70X and W402X mutations, the level of gentamicin-enhanced stop codon read-through is slightly less than the increment in activity caused by a lower-fidelity stop codon. In this system, gentamicin has more effect on read-through for the TAA and TGA stop codons compared with the TAG stop codon. In a mucopolysaccharidosis type I patient study, premature TGA stop codons were associated with a slightly attenuated clinical phenotype when compared with classic Hurler syndrome (eg, W402X/W402X and Q70X/Q70X genotypes with TAG stop codons). Natural read-through of premature stop codons is a potential explanation for the variable clinical phenotype in patients with mucopolysaccharidosis type I. Enhanced stop codon read-through is a potential treatment strategy for a large subgroup of patients with mucopolysaccharidosis type I.

In 25 Korean patients with Hunter syndrome, 20 mutations were identified, of which 13 mutations are novel: 6 small deletions (ie, 69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (ie, 21_22insG, 683_684insC), 2 terminations (ie, 529G>T, 637A>T), and 3 missense mutations (ie, 353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII restriction fragment length polymorphisms, 3 gene deletions were found. When the 20 mutations were depicted in a 3-dimensional model of iduronate 2 sulfatase protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas.

The candidate gene for mucopolysaccharidosis type IIIC has been localized to the pericentric region of chromosome 8 by linkage disequilibrium analysis.

Hamano et al1 immunohistochemically examined the involvement of tauopathy/synucleinopathy, cell death, and oxidative damage in the brains of 3 cases each of mucopolysaccharidosis IIIB and mucopolysaccharidosis II and age-matched controls. In cases of mucopolysaccharidosis IIIB, the density of GABAergic interneurons in the cerebral cortex immunoreactive for calbindin-D28K and parvalbumin was markedly reduced compared with age-matched controls. The swollen neurons showed immunoreactivity for phosphorylated alpha-synuclein but not for phosphorylated tau protein or beta-amyloid protein; those in the cerebral cortex demonstrated nuclear immunoreactivity for TUNEL, single-stranded DNA and 8-OHdG. Neither lipid peroxidation nor protein glycation was marked in mucopolysaccharidosis cases. The expression levels of superoxide dismutases (Cu/ZnSOD and MnSOD) and glial glutamate transporters (EAAT1 and EAAT2) were reduced in 2 mucopolysaccharidosis II cases.

The disturbance of GABAergic interneurons can be related to mental disturbance, while synucleinopathy and/or DNA impairment may be implicated in the neurodegeneration of swelling neurons, owing to storage materials in mucopolysaccharidosis IIIB cases. These findings suggest the possibility of neuroprotective therapies other than enzyme replacement in mucopolysaccharidosis patients.1

The transmembrane protein gene TMEM76, which encodes a 73-kd protein with predicted multiple transmembrane domains and glycosylation sites, was found. Northern blot analysis identified 2 major TMEM76 transcripts of 4.5 kb and 2.1 kb ubiquitously expressed in various human tissues. The highest expression was detected in leukocytes and in heart, lung, placenta, and liver cells, whereas the gene was expressed at a much lower level in the thymus, colon, and brain, which is consistent with the expression patterns of lysosomal proteins. A total of 27 TMEM76 mutations were identified in the DNA of 30 mucopolysaccharidosis IIIC–affected families, which were not found in DNA from 105 controls.2

Functional expression of human TMEM76 and the mouse orthologue demonstrates that this gene encodes the lysosomal GNAT. Furthermore, it suggests that this enzyme belongs to a new structural class of proteins that transport the activated acetyl residues across the cell membrane.2

Frequency

International

The prevalences are as follows: mucopolysaccharidosis type I-H, 1-2 cases per 100,000 population; mucopolysaccharidosis type I-S, 1 case per 250,000 population; mucopolysaccharidosis type II, 1 case per 100,000 population; mucopolysaccharidosis type III, 1 case per 25,000-75,000 population; and mucopolysaccharidosis type IV, 1 case per 40,000-200,000 population.

The prevalences of mucopolysaccharidosis types VI, VII, and I-H/S are unknown, but the prevalence of mucopolysaccharidosis type I-H/S approximates that of mucopolysaccharidosis type I-S.

According to the US National Institutes of Health, studies in Canada estimate 1 in 100,000 babies born has Hurler syndrome. The estimate for Hurler-Scheie syndrome is 1 in 115,000, and for Scheie syndrome, it is 1 in 500,000.

An epidemiologic study of the mucopolysaccharidoses in Western Australia using multiple ascertainment sources was performed and the incidence rate for the period 1969-1996 was estimated. An incidence of approximately 1 case in 107,000 live births was obtained for mucopolysaccharidosis type I-H (Hurler phenotype); 1 case in 320,000 live births (1 in 165,000 male live births) for mucopolysaccharidosis type II (Hunter syndrome); 1 case in 58,000 for mucopolysaccharidosis III (Sanfilippo syndrome); 1 case in 640,000 for mucopolysaccharidosis type IV-A (Morquio syndrome type A); and 1 case in 320,000 for mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome). The overall incidence for all types of mucopolysaccharidosis was approximately 1 case in 29,000 live births.

Murphy et al estimated the incidence (2001-2006) and prevalence (2002 census) of mucopolysaccharidosis type I in the Irish Republic (AOl) using population data. The birth incidence was 1 case in 26,206 births, with a carrier frequency of 1 case in 81 births. Of note, 19 (73%) of 26 Hurler syndrome patients were Irish Travelers. Amongst Irish Travelers, the incidence was 1 case in 371 persons, with a carrier frequency of 1 case in 10 persons. This is the highest recorded incidence worldwide.3

According to the incidence study covered the period from 1975-2004 in Sweden and Denmark and from 1979-2004 in Norway, the incidence of all mucopolysaccharidosis disorders was 1.75 cases in Sweden, 3.08 cases in Norway, and 1.77 cases in Denmark per 100 000 newborns. The incidence of mucopolysaccharidosis type I was the most common in all 3 countries, with 0.67, 1.85, and 0.54 cases per 100 000 newborns, respectively; for mucopolysaccharidosis type II, numbers were 0.27, 0.13, and 0.27 cases, respectively. For patients with other mucopolysaccharidosis disorders, the incidence varied widely. The prevalence for all mucopolysaccharidosis disorders was 4.24, 7.06, and 6.03 cases per million inhabitants in Sweden, Norway, and Denmark, respectively.4

Mortality/Morbidity

Patients with Hurler syndrome usually die by age 5-10 years. The life expectancy of patients with Scheie syndrome may be nearly normal. They can live until the fifth or sixth decade of life, and they can have healthy offspring. As for patients with Hunter and Sanfilippo syndromes, death usually occurs by the time of puberty. In the classic form of Morquio syndrome, long-term survival is rare, with death occurring in persons aged 20-40 years. In patients with the severe form of Maroteaux-Lamy syndrome, death usually occurs by early adulthood.

Age

Onset usually occurs in early childhood.

Clinical

History

Mucopolysaccharidosis usually manifests during infancy or early childhood.

  • The organs most involved include bone, the viscera, connective tissue, and the brain.
  • Dysostosis multiplex denotes the characteristic bony abnormalities.
  • Hepatosplenomegaly is a frequent finding.
  • Coarse facies, retinal disease, deafness, cardiovascular anomalies, and neurologic abnormalities can be present.
  • Common cutaneous findings are lichenified, dry, thick skin with diminished elasticity; increased pigmentation on the dorsum of the hands; sclerodermalike changes; hypertrichosis of the extremities; pale-colored hair; and alopecia areata.
  • Obstructive sleep apnea reportedly is a finding in children with mucopolysaccharidoses. Obstructive respiratory problems are common in patients with mucopolysaccharidosis. The severity of obstructive sleep apnea varies with each type of mucopolysaccharidosis.
  • Severe neurologic deficits and mental retardation are frequently associated with disrupted ganglioside metabolism in a variety of gangliosidoses and lysosomal storage disorders.
  • All types of mucopolysaccharidoses are linked with thickened and inelastic-appearing skin. Mucopolysaccharidosis type II (Hunter syndrome) reportedly is the only type with distinctive cutaneous findings; ivory-white papules or nodules 3-4 mm in diameter are present on the trunk, sometimes in a reticulate pattern. However, grouped skin-colored papules were described in a 5-year-old boy with Hurler-Scheie syndrome.

Physical

  • The onset of mucopolysaccharidosis type I-H (Hurler syndrome) occurs in early childhood (ie, 6-12 mo) with the following signs:
    • The skin is thickened and inelastic, as in other mucopolysaccharidoses. Hypertrichosis is common. Grouped skin-colored papules were described in 1 child with Hurler-Scheie syndrome.
    • Findings of generalized mongolian spots have been reported in newborns, which can lead to early detection and early treatment.5,6
    • Neurologic symptoms include hypertensive hydrocephalus syndrome, changes in the tonus of the musculature and the tendon reflex, and damage of the cranial nerves.
    • Myxedema may occur in patients with associated hypothyroidism.
    • Skeletal findings include dwarfism, with rather characteristic radiologic changes of the hands and the lumbar vertebral column; lumbar gibbus; stiff articulations; coarse facies; hip dysplasia; genu valgum; spine abnormalities; and hand abnormalities.
    • Other findings include hepatosplenomegaly and cardiovascular involvement. The cardiovascular findings include cardiac murmurs at the end of the second year and valvular heart disease; coronary artery insufficiency and peripheral vascular insufficiency are late findings. Fatal cardiomyopathy with autopsy-confirmed endocardial fibroelastosis has been reported.
    • CNS signs include progressive deterioration of intellect after a period of apparently normal development, debility, and speech disturbances. CNS lesions include lissencephaly, excessive ventricular enlargement and Dandy-Walker malformation with vermis atrophy, and cerebellar cysts. The association with lissencephaly is rare. The combination of mongolian spots and severe CNS lesions in Hurler syndrome is considered a rare clinical occurrence.
    • Ocular symptoms include progressive clouding of the cornea, megalocornea, hereditary glaucoma, and congestion and atrophy of the optic disc.
  • Mucopolysaccharidosis type I-S (Scheie syndrome) usually occurs in persons aged 5-15 years.
    • Skeletal findings include mild skeletal deformation and deformity of the hands. Growth may be normal.
    • Aortic stenosis or regurgitation may be present. Mucopolysaccharidosis IS patients have an impairment of ascending aortic elasticity. Measured with transthoracic echocardiography in mucopolysaccharidosis IS patients, aortic stiffness index was significantly increased, while aortic distensibility was significantly decreased compared with age- and sex-matched controls. Further follow-up studies are needed to examine arterial elasticity using other methods in this patient population and to detect possible effects of enzyme replacement therapy.7
    • Hepatosplenomegaly may be present.
    • Intelligence is usually normal.
  • The clinical signs of mucopolysaccharidosis type I-H/S (Hurler-Scheie syndrome) begin in persons aged 2-4 years; the signs are the same as those of mucopolysaccharidosis type I-H, but they are milder with a slower progression.
  • Mucopolysaccharidosis type II (Hunter syndrome) manifests in persons aged 1-3 years.
    • Clouding of the cornea does not occur, although patients have a pigmentary change in the ocular fundus with diminution of visual acuity and deposits of mucopolysaccharides.
    • Lumbar gibbus is rare in persons with Hunter syndrome.
    • Progressive deafness is a major problem. This also occurs in persons with Hurler syndrome, but severe mental retardation and early death make it a relatively inconspicuous feature.
    • Hepatosplenomegaly, stiff articulations, coarse facial features, and cardiovascular involvement occur as in Hurler syndrome.
    • Cutaneous manifestations include hirsutism; thickening of the skin, particularly over the fingers; and multiple, ivory-white, pebbly papules or nodules overlying the scapula and in the area of the posterior axillary fold. These nodules are most often localized symmetrically between the scapula angle and the linea axillaris posterior or on the thorax and the neck.
    • Papules with a pebbly appearance are a specific marker for the disease. These papules fade away through the digestion of a large amount of hyaluronic acid in cutaneous tissues by normal tissue histiocytes or enzymes of donor origin at an early stage after hematopoietic stem cell transplantation (SCT).8
    • Mongolian spots are observed at birth in 100% of Japanese, 96% of African American, 46% of the Hispanic, 9.5% of the white, 6.65% of Jewish, and 11.8% of Arab infants. They usually resolve and disappear by age 5-6 years. The most frequently involved region is the sacrococcygeal area, followed by gluteal and lumbar areas.9,10
    • The brain MRI abnormalities in patients with mucopolysaccharidosis types I and II who have only mild clinical manifestations are abnormal signal intensity in the white matter, widening of the cortical sulci, the size of the supratentorial ventricles, dilatation of the perivascular spaces, and enlargement of the subarachnoid spaces.11
    • Cerebral involvement is common. The increased myo-inositol-to-creatine (mI/Cr) ratio in patients with the neuronopathic form suggests the triggering of a glial response, and may be a surrogate marker of cerebral dysfunction in mucopolysaccharidosis II.
  • The main findings of mucopolysaccharidosis type III (Sanfilippo syndrome) are regression of psychomotor development and neurologic signs (eg, hyperactivity, autistic features, behavioral disorder), which occur in children aged 2-6 years.
    • The sleep disruption in Sanfilippo syndrome consists of an irregular sleep/wake pattern, which at its onset might appear as a disorder of initiating or maintaining sleep. This could explain why some patients do not respond to conventional hypnotics.
    • Dysmorphic features are relatively rare.
    • Other signs include thickened facial features, coarse hair, genu valgum, and a short neck. Hirsutism is common.
    • Children become inattentive and deteriorate rapidly, losing the power of speech.
    • Mild hepatosplenomegaly is common.
    • The course of the disease is progressive; most patients die before age 20 years.
    • Osteoporosis and osteomalacia are possible skeletal effects. They probably result from nutritional deficiencies and the inability to walk, rather than from the genetic defect itself. Secondary skeletal involvement in patients with mucopolysaccharidosis type III may represent a considerable cause of morbidity and requires intervention to reduce the risk of pathological fractures.
    • The 4-point scoring system was arranged to classify patients into groups with a rapid or slower course of mucopolysaccharidosis type IIIA. Meyer et al performed the first systematic and comprehensive study on the natural course of the disease.12
      • In the cohort of patients with mucopolysaccharidosis type IIIA, the first symptoms of disease were observed, on average, at age 7 months.
      • Speech and motor development were delayed in 66.2% and 33.9% of patients, respectively.
      • The median age at diagnosis was 4.5 years.
      • The onset of regression in speech, motor, and cognitive function was observed at an average of age 3.3 years. The loss of all 3 of the assessed abilities was observed at an average of age 12.5 years. Speech was lost before motor and cognitive functions. In a small group of patients who were older than 12.5 years (9.9%), speech, motor, and cognitive skills were partially preserved up to a maximum of age 23.8 years.
      • The 4-point scoring system may have an important impact on parental counseling, as well as therapeutic interventions.
  • Mucopolysaccharidosis type IV (Morquio syndrome) is characterized by abnormalities of the skeletal system (eg, kyphoscoliosis, pectus carinatum, luxation of the hips), aortic valvular disease, and dental abnormalities.
    • The clinical and radiographic appearances of the teeth resemble hypoplastic amelogenesis imperfecta with thin enamel of normal radiodensity.
    • Odontoid hypoplasia is common and can lead to deadly atlantoaxial instability if not treated.
    • Ophthalmologically, diffuse corneal opacification and alterations of the trabecular meshwork occasionally lead to glaucoma.
    • In Morquiolike syndrome, hearing deficits, dental abnormalities, cardiac murmurs, hepatomegaly, and joint laxity are absent.
  • In mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome), the first clinical signs usually appear in the first 2 years of life and manifest as psychomotor retardation.
    • This syndrome resembles Hurler syndrome with typical facial changes.
    • Slowly, the thoracic deformity appears. Lumbar kyphosis, limited joint mobility, and a claw position of the hands are also present.
    • Usually, hepatosplenomegaly is present; less often, only splenomegaly is present.
    • Intelligence is usually normal, but visual and hearing impairments are present.
    • Compression of the spinal cord with successive neurologic complications can appear because of hypoplasia of the cervical vertebrae.
    • A large head, short neck, corneal opacity, open mouth associated with an enlarged tongue, enlargement of skull, and a long anteroposterior dimension are the main characteristic features.
    • Dental complications include unerupted dentition, dentigerous cystlike follicles, malocclusions, condylar defects, and gingival hyperplasia.13
    • Altered metabolism of GAGs in the extracellular matrix can contribute to the development of the left ventricular aneurysm.14
  • Early after birth, children with mucopolysaccharidosis type VII have hepatosplenomegaly and facial deformities, such as hypertelorism, a prominent maxilla, and a depressed bridge of the nose.
    • Dwarfism with pectus carinatum and kyphosis is present.
    • Children have frequent upper respiratory tract infections.
    • Many develop corneal clouding.
    • Mental retardation is mild.
    • Craniovertebral instability and spinal cord compression can occur in persons with mucopolysaccharidosis type VII (Sly syndrome), with deposition of GAGs at the craniovertebral junction.15
    • A very rare finding is fetal hydrops.16

Causes

See Pathophysiology.

More on Mucopolysaccharidoses Types I-VII

Overview: Mucopolysaccharidoses Types I-VII
Differential Diagnoses & Workup: Mucopolysaccharidoses Types I-VII
Treatment & Medication: Mucopolysaccharidoses Types I-VII
Follow-up: Mucopolysaccharidoses Types I-VII
References

References

  1. Hamano K, Hayashi M, Shioda K, Fukatsu R, Mizutani S. Mechanisms of neurodegeneration in mucopolysaccharidoses II and IIIB: analysis of human brain tissue. Acta Neuropathol. May 2008;115(5):547-59. [Medline].

  2. Hrebicek M, Mrazova L, Seyrantepe V, et al. Mutations in TMEM76* cause mucopolysaccharidosis IIIC (Sanfilippo C syndrome). Am J Hum Genet. Nov 2006;79(5):807-19. [Medline].

  3. Murphy AM, Lambert D, Treacy EP, O'Meara A, Lynch SA. Incidence and prevalence of mucopolysaccharidosis type 1 in the Irish republic. Arch Dis Child. Jan 2009;94(1):52-4. [Medline].

  4. Malm G, Lund AM, Mansson JE, Heiberg A. Mucopolysaccharidoses in the Scandinavian countries: incidence and prevalence. Acta Paediatr. Nov 2008;97(11):1577-81. [Medline].

  5. Ashrafi MR, Shabanian R, Mohammadi M, Kavusi S. Extensive Mongolian spots: a clinical sign merits special attention. Pediatr Neurol. Feb 2006;34(2):143-5. [Medline].

  6. Panteliadis CP, Karatza ED, Tzitiridou MK, Koliouskas DE, Spiroglou KS. Lissencephaly and mongolian spots in Hurler syndrome. Pediatr Neurol. Jul 2003;29(1):59-62. [Medline].

  7. Nemes A, Timmermans RG, Wilson JH, et al. The mild form of mucopolysaccharidosis type I (Scheie syndrome) is associated with increased ascending aortic stiffness. Heart Vessels. Mar 2008;23(2):108-11. [Medline].

  8. Demitsu T, Kakurai M, Okubo Y, et al. Skin eruption as the presenting sign of Hunter syndrome IIB. Clin Exp Dermatol. May 1999;24(3):179-82. [Medline].

  9. Sapadin AN, Friedman IS. Extensive Mongolian spots associated with Hunter syndrome. J Am Acad Dermatol. Dec 1998;39(6):1013-5. [Medline].

  10. Ochiai T, Suzuki Y, Kato T, et al. Natural history of extensive Mongolian spots in mucopolysaccharidosis type II (Hunter syndrome): a survey among 52 Japanese patients. J Eur Acad Dermatol Venereol. Sep 2007;21(8):1082-5. [Medline].

  11. Schwartz I, Vedolin L, Jardim LB, et al. Brain magnetic resonance imaging and spectroscopic findings inmucopolysaccharidosis type II. Acta Paediatrica. 2007;96:109-11.

  12. Meyer A, Kossow K, Gal A, et al. Scoring evaluation of the natural course of mucopolysaccharidosis type IIIA (Sanfilippo syndrome type A). Pediatrics. Nov 2007;120(5):e1255-61. [Medline].

  13. Alpoz AR, Coker M, Celen E, et al. The oral manifestations of Maroteaux-Lamy syndrome (mucopolysaccharidosis VI): a case report. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. May 2006;101(5):632-7. [Medline].

  14. Oudit GY, Butany J, Williams WG, Siu SC, Clarke JT, Iwanochko RM. Left ventricular aneurysm in a patient with mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome): clinical and pathological correlation. Cardiovasc Pathol. Jul-Aug 2007;16(4):237-40. [Medline].

  15. Dickerman RD, Colle KO, Bruno CA Jr, Schneider SJ. Craniovertebral instability with spinal cord compression in a 17-month-old boy with Sly syndrome (mucopolysaccharidosis type VII): a surgical dilemma. Spine. Mar 1 2004;29(5):E92-4. [Medline].

  16. Venkat-Raman N, Sebire NJ, Murphy KW. Recurrent fetal hydrops due to mucopolysaccharidoses type VII. Fetal Diagn Ther. 2006;21(3):250-4. [Medline].

  17. Gallegos-Arreola MP, Machorro-Lazo MV, Flores-Martinez SE, et al. Urinary glycosaminoglycan excretion in healthy subjects and in patients with mucopolysaccharidoses. Arch Med Res. Sep-Oct 2000;31(5):505-10. [Medline].

  18. Dean CJ, Bockmann MR, Hopwood JJ, Brooks DA, Meikle PJ. Detection of mucopolysaccharidosis type II by measurement of iduronate-2-sulfatase in dried blood spots and plasma samples. Clin Chem. Apr 2006;52(4):643-9. [Medline].

  19. Gabrielli O, Polonara G, Regnicolo L, et al. Correlation between cerebral MRI abnormalities and mental retardation in patients with mucopolysaccharidoses. Am J Med Genet A. Mar 15 2004;125A(3):224-31. [Medline].

  20. Matheus MG, Castillo M, Smith JK, Armao D, Towle D, Muenzer J. Brain MRI findings in patients with mucopolysaccharidosis types I and II and mild clinical presentation. Neuroradiology. Aug 2004;46(8):666-72. [Medline].

  21. Di Natale P, Villani GR, Parini R, et al. Molecular markers for the follow-up of enzyme-replacement therapy in mucopolysaccharidosis type VI disease. Biotechnol Appl Biochem. Mar 2008;49:219-23. [Medline].

  22. Husain AM, Escolar ML, Kurtzberg J. Neurophysiologic assessment of mucopolysaccharidosis III. Clin Neurophysiol. Sep 2006;117(9):2059-63. [Medline].

  23. Cimaz R, Vijay S, Haase C, et al. Attenuated type I mucopolysaccharidosis in the differential diagnosis of juvenile idiopathic arthritis: a series of 13 patients with Scheie syndrome. Clin Exp Rheumatol. Mar-Apr 2006;24(2):196-202. [Medline].

  24. Anawis MA. Hunter syndrome (MPS II-B): a report of bilateral vitreous floaters and maculopathy. Ophthalmic Genet. Jun 2006;27(2):71-2. [Medline].

  25. Blanchard S, Sadilek M, Scott CR, Turecek F, Gelb MH. Tandem mass spectrometry for the direct assay of lysosomal enzymes in dried blood spots: application to screening newborns for mucopolysaccharidosis I. Clin Chem. Dec 2008;54(12):2067-70. [Medline].

  26. Randall DR, Colobong KE, Hemmelgarn H, et al. Heparin cofactor II-thrombin complex: a biomarker of MPS disease. Mol Genet Metab. Aug 2008;94(4):456-61. [Medline].

  27. Braunlin EA, Berry JM, Whitley CB. Cardiac findings after enzyme replacement therapy for mucopolysaccharidosis type I. Am J Cardiol. Aug 1 2006;98(3):416-8. [Medline].

  28. Gassas A, Sung L, Doyle JJ, Clarke JT, Saunders EF. Life-threatening pulmonary hemorrhages post bone marrow transplantation in Hurler syndrome. Report of three cases and review of the literature. Bone Marrow Transplant. Jul 2003;32(2):213-5. [Medline].

  29. Grewal SS, Krivit W, Defor TE, et al. Outcome of second hematopoietic cell transplantation in Hurler syndrome. Bone Marrow Transplant. Mar 2002;29(6):491-6. [Medline].

  30. Harmatz P, Whitley CB, Waber L, et al. Enzyme replacement therapy in mucopolysaccharidosis VI (Maroteaux-Lamy syndrome). J Pediatr. May 2004;144(5):574-80. [Medline].

  31. Muenzer J, Wraith JE, Beck M, et al. A phase II/III clinical study of enzyme replacement therapy with idursulfase in mucopolysaccharidosis II (Hunter syndrome). Genet Med. Aug 2006;8(8):465-73. [Medline].

  32. Wraith JE, Clarke LA, Beck M, et al. Enzyme replacement therapy for mucopolysaccharidosis I: a randomized, double-blinded, placebo-controlled, multinational study of recombinant human alpha-L-iduronidase (laronidase). J Pediatr. May 2004;144(5):581-8. [Medline].

  33. Muenzer J, Wraith JE, Clarke LA. Mucopolysaccharidosis I: management and treatment guidelines. Pediatrics. Jan 2009;123(1):19-29. [Medline].

  34. Harmatz P, Giugliani R, Schwartz I, et al. Enzyme replacement therapy for mucopolysaccharidosis VI: a phase 3, randomized, double-blind, placebo-controlled, multinational study of recombinant human N-acetylgalactosamine 4-sulfatase (recombinant human arylsulfatase B or rhASB) and follow-on, open-label extension study. J Pediatr. Apr 2006;148(4):533-539. [Medline].

  35. Hein LK, Bawden M, Muller VJ, Sillence D, Hopwood JJ, Brooks DA. alpha-L-iduronidase premature stop codons and potential read-through in mucopolysaccharidosis type I patients. J Mol Biol. Apr 30 2004;338(3):453-62. [Medline].

  36. Caillaud C, Poenaru L. Gene therapy in lysosomal diseases. Biomed Pharmacother. Oct 2000;54(10):505-12. [Medline].

  37. Fu H, Samulski RJ, McCown TJ, Picornell YJ, Fletcher D, Muenzer J. Neurological correction of lysosomal storage in a mucopolysaccharidosis IIIB mouse model by adeno-associated virus-mediated gene delivery. Mol Ther. Jan 2002;5(1):42-9. [Medline].

  38. Gosele S, Dithmar S, Holz FG, Volcker HE. [Late diagnosis of Morquio syndrome. Clinical histopathological findings in a rare mucopolysaccharidosis]. Klin Monatsbl Augenheilkd. Aug 2000;217(2):114-7. [Medline].

  39. Ito K, Ochiai T, Suzuki H, Chin M, Shichino H, Mugishima H. The effect of haematopoietic stem cell transplant on papules with 'pebbly' appearance in Hunter's syndrome. Br J Dermatol. Jul 2004;151(1):207-11. [Medline].

  40. Jeong HS, Cho DY, Ahn KM, Jin DK. Complications of tracheotomy in patients with mucopolysaccharidoses type II (Hunter syndrome). Int J Pediatr Otorhinolaryngol. Oct 2006;70(10):1765-9. [Medline].

  41. Kakavanos R, Turner CT, Hopwood JJ, Kakkis ED, Brooks DA. Immune tolerance after long-term enzyme-replacement therapy among patients who have mucopolysaccharidosis I. Lancet. May 10 2003;361(9369):1608-13. [Medline].

  42. Kakkis ED, Muenzer J, Tiller GE, et al. Enzyme-replacement therapy in mucopolysaccharidosis I. N Engl J Med. Jan 18 2001;344(3):182-8. [Medline].

  43. Keeling KM, Brooks DA, Hopwood JJ, Li P, Thompson JN, Bedwell DM. Gentamicin-mediated suppression of Hurler syndrome stop mutations restores a low level of alpha-L-iduronidase activity and reduces lysosomal glycosaminoglycan accumulation. Hum Mol Genet. Feb 1 2001;10(3):291-9. [Medline].

  44. Kim CH, Hwang HZ, Song SM, et al. Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations. Hum Mutat. Apr 2003;21(4):449-50. [Medline].

  45. Krivit W. Allogeneic stem cell transplantation for the treatment of lysosomal and peroxisomal metabolic diseases. Springer Semin Immunopathol. Nov 2004;26(1-2):119-32. [Medline].

  46. Lee V, Li CK, Shing MM, et al. Umbilical cord blood transplantation for Maroteaux-Lamy syndrome (mucopolysaccharidosis type VI). Bone Marrow Transplant. Aug 2000;26(4):455-8. [Medline].

  47. Leighton SE, Papsin B, Vellodi A, Dinwiddie R, Lane R. Disordered breathing during sleep in patients with mucopolysaccharidoses. Int J Pediatr Otorhinolaryngol. Apr 27 2001;58(2):127-38. [Medline].

  48. Mahalingam K, Janani S, Priya S, Elango EM, Sundari RM. Diagnosis of mucopolysaccharidoses: how to avoid false positives and false negatives. Indian J Pediatr. Jan 2004;71(1):29-32. [Medline].

  49. Mariotti P, Della Marca G, Iuvone L, et al. Sleep disorders in Sanfilippo syndrome: a polygraphic study. Clin Electroencephalogr. Jan 2003;34(1):18-22. [Medline].

  50. Mok A, Cao H, Hegele RA. Genomic basis of mucopolysaccharidosis type IIID (MIM 252940) revealed by sequencing of GNS encoding N-acetylglucosamine-6-sulfatase. Genomics. Jan 2003;81(1):1-5. [Medline].

  51. Nelson J, Crowhurst J, Carey B, Greed L. Incidence of the mucopolysaccharidoses in Western Australia. Am J Med Genet A. Dec 15 2003;123A(3):310-3. [Medline].

  52. Prystowsky SD, Maumenee IH, Freeman RG, Herndon JH Jr, Harrod MJ. A cutaneous marker in the Hunter syndrome a report of four cases. Arch Dermatol. May 1977;113(5):602-5. [Medline].

  53. Punnett A, Bliss B, Dupuis LL, Abdolell M, Doyle J, Sung L. Ototoxicity following pediatric hematopoietic stem cell transplantation: a prospective cohort study. Pediatr Blood Cancer. Jun 2004;42(7):598-603. [Medline].

  54. Rigante D, Caradonna P. Secondary skeletal involvement in Sanfilippo syndrome. QJM. Apr 2004;97(4):205-9. [Medline].

  55. Ross CJ, Bastedo L, Maier SA, Sands MS, Chang PL. Treatment of a lysosomal storage disease, mucopolysaccharidosis VII, with microencapsulated recombinant cells. Hum Gene Ther. Oct 10 2000;11(15):2117-27. [Medline].

  56. Sands MS, Barker JE, Vogler C, et al. Treatment of murine mucopolysaccharidosis type VII by syngeneic bone marrow transplantation in neonates. Lab Invest. Jun 1993;68(6):676-86. [Medline].

  57. Schiro JA, Mallory SB, Demmer L, Dowton SB, Luke MC. Grouped papules in Hurler-Scheie syndrome. J Am Acad Dermatol. Nov 1996;35(5 Pt 2):868-70. [Medline].

  58. Scriver RC, Beaudet AL, Sly WS. The Metabolic and Molecular Bases of Inherited Disease. New York, NY: McGraw-Hill; 1995.

  59. Seyrantepe V, Tihy F, Pshezhetsky AV. The microcell-mediated transfer of human chromosome 8 restores the deficient N-acetylytransferase activity in skin fibroblasts of Mucopolysaccharidosis type IIIC patients. Hum Genet. Sep 2006;120(2):293-6. [Medline].

  60. Shinhar SY, Zablocki H, Madgy DN. Airway management in mucopolysaccharide storage disorders. Arch Otolaryngol Head Neck Surg. Feb 2004;130(2):233-7. [Medline].

  61. Weisstein JS, Delgado E, Steinbach LS, Hart K, Packman S. Musculoskeletal manifestations of Hurler syndrome: long-term follow-up after bone marrow transplantation. J Pediatr Orthop. Jan-Feb 2004;24(1):97-101. [Medline].

  62. Whitley CB, Belani KG, Chang PN, et al. Long-term outcome of Hurler syndrome following bone marrow transplantation. Am J Med Genet. Apr 15 1993;46(2):209-18. [Medline].

  63. Wolanczyk T, Banaszkiewicz A, Mierzewska H, Czartoryska B, Zdziennicka E. [Hyperactivity and behavioral disorders in Sanfilippo A (mucopolysaccharidosis type IIIA)--case report and review of the literature]. Psychiatr Pol. Sep-Oct 2000;34(5):831-7. [Medline].

Further Reading

Keywords

mucopolysaccharidosis, MPS, lysosomal storage disease, glycosaminoglycans, GAGs, MPS type I-H, Hurler syndrome, MPS type I-S, Scheie syndrome, MPS type V, MPS type I-H/S, Hurler-Scheie syndrome, MPS type II, Hunter syndrome, MPS type III-A, Sanfilippo syndrome type A, MPS III-B, Sanfilippo syndrome type B, MPS III-C, Sanfilippo syndrome type C, MPS type III-D, Sanfilippo syndrome type D, MPS type IV-A, Morquio syndrome, MPS type IV-B, MPS type VI, Maroteaux-Lamy syndrome, MPS type VII, Sly syndrome

Contributor Information and Disclosures

Author

Janette Baloghova, MD, PhD, Lecturer, Department of Dermatology, Medical Faculty, University of PJ Safarik at Kosice, Slovak Republic
Disclosure: Nothing to disclose.

Coauthor(s)

Robert A Schwartz, MD, MPH, Professor and Head, Dermatology, Professor of Pathology, Pediatrics, Medicine, and Preventive Medicine and Community Health, UMDNJ-New Jersey Medical School
Robert A Schwartz, MD, MPH is a member of the following medical societies: Alpha Omega Alpha, American Academy of Dermatology, American College of Physicians, and Sigma Xi
Disclosure: Nothing to disclose.

Zuzana Baranova, MD, PhD, Senior Lecturer, Department of Dermatology, University of PJ Safarik at Kosice, Slovak Republic
Disclosure: Nothing to disclose.

Medical Editor

Jacek C Szepietowski, MD, PhD, Professor, Vice-Head, Department of Dermatology, Venereology and Allergology, Wroclaw Medical University; Director of the Institute of Immunology and Experimental Therapy, Polish Academy of Sciences, Poland
Disclosure: Stiefel Salary Employment; Orfagen Consulting fee Consulting; Maruho Consulting fee Consulting; Astellas Consulting fee Consulting

Pharmacy Editor

David F Butler, MD, Professor of Dermatology, Texas A&M University College of Medicine; Chair, Department of Dermatology, Director, Dermatology Residency Training Program, Scott and White Clinic, Northside Clinic
David F Butler, MD is a member of the following medical societies: Alpha Omega Alpha, American Academy of Dermatology, American Medical Association, American Society for Dermatologic Surgery, American Society for MOHS Surgery, Association of Military Dermatologists, and Phi Beta Kappa
Disclosure: Nothing to disclose.

Managing Editor

Jeffrey J Miller, MD, Associate Professor of Dermatology, Penn State University College of Medicine; Staff Dermatologist, Penn State Milton S Hershey Medical Center
Jeffrey J Miller, MD is a member of the following medical societies: Alpha Omega Alpha, American Academy of Dermatology, Association of Professors of Dermatology, North American Hair Research Society, and Society for Investigative Dermatology
Disclosure: Nothing to disclose.

CME Editor

Catherine Quirk, MD, Clinical Assistant Professor, Department of Dermatology, Brown University
Catherine Quirk, MD is a member of the following medical societies: Alpha Omega Alpha and American Academy of Dermatology
Disclosure: Nothing to disclose.

Chief Editor

William D James, MD, Paul R Gross Professor of Dermatology, University of Pennsylvania School of Medicine; Vice-Chair, Program Director, Department of Dermatology, University of Pennsylvania Health System
William D James, MD is a member of the following medical societies: American Academy of Dermatology and Society for Investigative Dermatology
Disclosure: elsevier Royalty Other; american college of physicians Honoraria Other

 
 
HONcode

We subscribe to the
HONcode principles of the
Health On the Net Foundation

All material on this website is protected by copyright, Copyright© 1994- by Medscape.
This website also contains material copyrighted by 3rd parties.

DISCLAIMER: The content of this Website is not influenced by sponsors. The site is designed primarily for use by qualified physicians and other medical professionals. The information contained herein should NOT be used as a substitute for the advice of an appropriately qualified and licensed physician or other health care provider. The information provided here is for educational and informational purposes only. In no way should it be considered as offering medical advice. Please check with a physician if you suspect you are ill.