eMedicine Specialties > Dermatology > Pediatric Diseases

Mucopolysaccharidoses Types I-VII

Janette Baloghova, MD, PhD, Lecturer, Department of Dermatology, Medical Faculty, University of PJ Safarik at Kosice, Slovak Republic
Robert A Schwartz, MD, MPH, Professor and Head, Dermatology, Professor of Pathology, Pediatrics, Medicine, and Preventive Medicine and Community Health, UMDNJ-New Jersey Medical School; Zuzana Baranova, MD, PhD, Senior Lecturer, Department of Dermatology, University of PJ Safarik at Kosice, Slovak Republic

Updated: May 21, 2009

Introduction

Background

Mucopolysaccharidoses (MPSs) are a group of lysosomal storage diseases, each of which is produced by an inherited deficiency of an enzyme involved in the degradation of acid mucopolysaccharides, now called glycosaminoglycans (GAGs). These diseases are autosomal recessive, except for mucopolysaccharidosis type II, which is X-linked.

In addition to the eMedicine orthopedics article Mucopolysaccharidosis, the following are eMedicine’s pediatrics articles on mucopolysaccharidoses:

• Mucopolysaccharidosis Type I
• Mucopolysaccharidosis Type II
• Mucopolysaccharidosis Type III
• Mucopolysaccharidosis Type IV
• Mucopolysaccharidosis Type VI
• Mucopolysaccharidosis Type VII

Pathophysiology

GAGs are long, linear polysaccharide molecules composed of repeating dimers, each of which contains a hexuronic acid (or galactose in the case of keratan sulfate) and an amino sugar. The large proteoglycan molecules made up of protein cores, and GAG branches are secreted by cells and constitute a significant fraction of the extracellular matrix of connective tissue. The turnover of these molecules depends on their subsequent internalization by endocytosis, their delivery to the lysosomes, and their digestion by lysosomal enzymes. The enzyme deficiencies lead to the accumulation of mucopolysaccharides in the lysosomes of the cells in the connective tissue and to an increase in their excretion in the urine. The types of mucopolysaccharidoses linked to specific enzyme deficiencies are listed below; some have been assigned an Enzyme Commission (EC) number.

Types of Mucopolysaccharidoses and Associated Enzyme Deficiencies

The enzyme synthesis is controlled at the following gene loci:

• 4p16.3 (Hurler syndrome, Scheie syndrome): The activity of alpha-L-iduronidase is decreased in Hurler syndrome and Scheie syndrome. However, Hurler syndrome is a severe form of the same heavy mucopolysaccharidosis, with affected children dying after several years, whereas Scheie disease has a mild clinical phenotype. In some populations, premature stop mutations represent roughly two thirds of the mutations that cause Hurler syndrome.
• 12q14 (Sanfilippo syndrome): The diagnosis requires a specific lysosomal enzyme assay for glucosamine (N -acetyl)-6-sulfatase (GNS) activity. A homozygous nonsense mutation is found in exon 9 (1063C --> T), which predicts premature termination of translation (R355X). In addition, 2 common synonymous coding single-nucleotide polymorphisms are found and genotyped in samples from 4 ethnic groups.
• 16q24.3 (Morquio syndrome): The deficiency of enzymes in Morquio syndrome type A or type B leads to the accumulation of keratan sulfate and chondroitin-6-sulfate in the connective tissue, the skeletal system, and the teeth.
• 5q11-q13 (Maroteaux-Lamy syndrome)
• Xq27.3-q28 (Hunter syndrome)

A new mutation has been reported, making a total of 15 different mutations that can cause premature stop codons in the alpha-L-iduronidase gene (IDUA), and the biochemistry of these mutations has been investigated. Natural stop codon read-through is dependent on the fidelity of the codon when evaluated at Q70X and W402X in CHO-K1 cells, but the 3 possible stop codons, TAA, TAG, and TGA, have different effects on mRNA stability, and this effect is context dependent.

In CHO-K1 cells expressing the Q70X and W402X mutations, the level of gentamicin-enhanced stop codon read-through is slightly less than the increment in activity caused by a lower-fidelity stop codon. In this system, gentamicin has more effect on read-through for the TAA and TGA stop codons compared with the TAG stop codon. In a mucopolysaccharidosis type I patient study, premature TGA stop codons were associated with a slightly attenuated clinical phenotype when compared with classic Hurler syndrome (eg, W402X/W402X and Q70X/Q70X genotypes with TAG stop codons). Natural read-through of premature stop codons is a potential explanation for the variable clinical phenotype in patients with mucopolysaccharidosis type I. Enhanced stop codon read-through is a potential treatment strategy for a large subgroup of patients with mucopolysaccharidosis type I.

In 25 Korean patients with Hunter syndrome, 20 mutations were identified, of which 13 mutations are novel: 6 small deletions (ie, 69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (ie, 21_22insG, 683_684insC), 2 terminations (ie, 529G>T, 637A>T), and 3 missense mutations (ie, 353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII restriction fragment length polymorphisms, 3 gene deletions were found. When the 20 mutations were depicted in a 3-dimensional model of iduronate 2 sulfatase protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas.

The candidate gene for mucopolysaccharidosis type IIIC has been localized to the pericentric region of chromosome 8 by linkage disequilibrium analysis.

Hamano et al¹ immunohistochemically examined the involvement of tauopathy/synucleinopathy, cell death, and oxidative damage in the brains of 3 cases each of mucopolysaccharidosis IIIB and mucopolysaccharidosis II and age-matched controls. In cases of mucopolysaccharidosis IIIB, the density of GABAergic interneurons in the cerebral cortex immunoreactive for calbindin-D28K and parvalbumin was markedly reduced compared with age-matched controls. The swollen neurons showed immunoreactivity for phosphorylated alpha-synuclein but not for phosphorylated tau protein or beta-amyloid protein; those in the cerebral cortex demonstrated nuclear immunoreactivity for TUNEL, single-stranded DNA and 8-OHdG. Neither lipid peroxidation nor protein glycation was marked in mucopolysaccharidosis cases. The expression levels of superoxide dismutases (Cu/ZnSOD and MnSOD) and glial glutamate transporters (EAAT1 and EAAT2) were reduced in 2 mucopolysaccharidosis II cases.

The disturbance of GABAergic interneurons can be related to mental disturbance, while synucleinopathy and/or DNA impairment may be implicated in the neurodegeneration of swelling neurons, owing to storage materials in mucopolysaccharidosis IIIB cases. These findings suggest the possibility of neuroprotective therapies other than enzyme replacement in mucopolysaccharidosis patients.¹

The transmembrane protein gene TMEM76, which encodes a 73-kd protein with predicted multiple transmembrane domains and glycosylation sites, was found. Northern blot analysis identified 2 major TMEM76 transcripts of 4.5 kb and 2.1 kb ubiquitously expressed in various human tissues. The highest expression was detected in leukocytes and in heart, lung, placenta, and liver cells, whereas the gene was expressed at a much lower level in the thymus, colon, and brain, which is consistent with the expression patterns of lysosomal proteins. A total of 27 TMEM76 mutations were identified in the DNA of 30 mucopolysaccharidosis IIIC–affected families, which were not found in DNA from 105 controls.²

Functional expression of human TMEM76 and the mouse orthologue demonstrates that this gene encodes the lysosomal GNAT. Furthermore, it suggests that this enzyme belongs to a new structural class of proteins that transport the activated acetyl residues across the cell membrane.²

Frequency

International

The prevalences are as follows: mucopolysaccharidosis type I-H, 1-2 cases per 100,000 population; mucopolysaccharidosis type I-S, 1 case per 250,000 population; mucopolysaccharidosis type II, 1 case per 100,000 population; mucopolysaccharidosis type III, 1 case per 25,000-75,000 population; and mucopolysaccharidosis type IV, 1 case per 40,000-200,000 population.

The prevalences of mucopolysaccharidosis types VI, VII, and I-H/S are unknown, but the prevalence of mucopolysaccharidosis type I-H/S approximates that of mucopolysaccharidosis type I-S.

According to the US National Institutes of Health, studies in Canada estimate 1 in 100,000 babies born has Hurler syndrome. The estimate for Hurler-Scheie syndrome is 1 in 115,000, and for Scheie syndrome, it is 1 in 500,000.

An epidemiologic study of the mucopolysaccharidoses in Western Australia using multiple ascertainment sources was performed and the incidence rate for the period 1969-1996 was estimated. An incidence of approximately 1 case in 107,000 live births was obtained for mucopolysaccharidosis type I-H (Hurler phenotype); 1 case in 320,000 live births (1 in 165,000 male live births) for mucopolysaccharidosis type II (Hunter syndrome); 1 case in 58,000 for mucopolysaccharidosis III (Sanfilippo syndrome); 1 case in 640,000 for mucopolysaccharidosis type IV-A (Morquio syndrome type A); and 1 case in 320,000 for mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome). The overall incidence for all types of mucopolysaccharidosis was approximately 1 case in 29,000 live births.

Mortality/Morbidity

Patients with Hurler syndrome usually die by age 5-10 years. The life expectancy of patients with Scheie syndrome may be nearly normal. They can live until the fifth or sixth decade of life, and they can have healthy offspring. As for patients with Hunter and Sanfilippo syndromes, death usually occurs by the time of puberty. In the classic form of Morquio syndrome, long-term survival is rare, with death occurring in persons aged 20-40 years. In patients with the severe form of Maroteaux-Lamy syndrome, death usually occurs by early adulthood.

Age

Onset usually occurs in early childhood.

Clinical

History

Mucopolysaccharidosis usually manifests during infancy or early childhood.

• The organs most involved include bone, the viscera, connective tissue, and the brain.
• Dysostosis multiplex denotes the characteristic bony abnormalities.
• Hepatosplenomegaly is a frequent finding.
• Coarse facies, retinal disease, deafness, cardiovascular anomalies, and neurologic abnormalities can be present.
• Common cutaneous findings are lichenified, dry, thick skin with diminished elasticity; increased pigmentation on the dorsum of the hands; sclerodermalike changes; hypertrichosis of the extremities; pale-colored hair; and alopecia areata.
• Obstructive sleep apnea reportedly is a finding in children with mucopolysaccharidoses. Obstructive respiratory problems are common in patients with mucopolysaccharidosis. The severity of obstructive sleep apnea varies with each type of mucopolysaccharidosis.
• Severe neurologic deficits and mental retardation are frequently associated with disrupted ganglioside metabolism in a variety of gangliosidoses and lysosomal storage disorders.
• All types of mucopolysaccharidoses are linked with thickened and inelastic-appearing skin. Mucopolysaccharidosis type II (Hunter syndrome) reportedly is the only type with distinctive cutaneous findings; ivory-white papules or nodules 3-4 mm in diameter are present on the trunk, sometimes in a reticulate pattern. However, grouped skin-colored papules were described in a 5-year-old boy with Hurler-Scheie syndrome.

Physical

• The onset of mucopolysaccharidosis type I-H (Hurler syndrome) occurs in early childhood (ie, 6-12 mo) with the following signs:
  • The skin is thickened and inelastic, as in other mucopolysaccharidoses. Hypertrichosis is common. Grouped skin-colored papules were described in 1 child with Hurler-Scheie syndrome.
  • Findings of generalized mongolian spots have been reported in newborns, which can lead to early detection and early treatment.^5,6
  • Neurologic symptoms include hypertensive hydrocephalus syndrome, changes in the tonus of the musculature and the tendon reflex, and damage of the cranial nerves.
  • Myxedema may occur in patients with associated hypothyroidism.
  • Skeletal findings include dwarfism, with rather characteristic radiologic changes of the hands and the lumbar vertebral column; lumbar gibbus; stiff articulations; coarse facies; hip dysplasia; genu valgum; spine abnormalities; and hand abnormalities.
  • Other findings include hepatosplenomegaly and cardiovascular involvement. The cardiovascular findings include cardiac murmurs at the end of the second year and valvular heart disease; coronary artery insufficiency and peripheral vascular insufficiency are late findings. Fatal cardiomyopathy with autopsy-confirmed endocardial fibroelastosis has been reported.
  • CNS signs include progressive deterioration of intellect after a period of apparently normal development, debility, and speech disturbances. CNS lesions include lissencephaly, excessive ventricular enlargement and Dandy-Walker malformation with vermis atrophy, and cerebellar cysts. The association with lissencephaly is rare. The combination of mongolian spots and severe CNS lesions in Hurler syndrome is considered a rare clinical occurrence.
  • Ocular symptoms include progressive clouding of the cornea, megalocornea, hereditary glaucoma, and congestion and atrophy of the optic disc.
• Mucopolysaccharidosis type I-S (Scheie syndrome) usually occurs in persons aged 5-15 years.
  • Skeletal findings include mild skeletal deformation and deformity of the hands. Growth may be normal.
  • Aortic stenosis or regurgitation may be present. Mucopolysaccharidosis IS patients have an impairment of ascending aortic elasticity. Measured with transthoracic echocardiography in mucopolysaccharidosis IS patients, aortic stiffness index was significantly increased, while aortic distensibility was significantly decreased compared with age- and sex-matched controls. Further follow-up studies are needed to examine arterial elasticity using other methods in this patient population and to detect possible effects of enzyme replacement therapy.⁷
  • Hepatosplenomegaly may be present.
  • Intelligence is usually normal.
• The clinical signs of mucopolysaccharidosis type I-H/S (Hurler-Scheie syndrome) begin in persons aged 2-4 years; the signs are the same as those of mucopolysaccharidosis type I-H, but they are milder with a slower progression.
• Mucopolysaccharidosis type II (Hunter syndrome) manifests in persons aged 1-3 years.
  • Clouding of the cornea does not occur, although patients have a pigmentary change in the ocular fundus with diminution of visual acuity and deposits of mucopolysaccharides.
  • Lumbar gibbus is rare in persons with Hunter syndrome.
  • Progressive deafness is a major problem. This also occurs in persons with Hurler syndrome, but severe mental retardation and early death make it a relatively inconspicuous feature.
  • Hepatosplenomegaly, stiff articulations, coarse facial features, and cardiovascular involvement occur as in Hurler syndrome.
  • Cutaneous manifestations include hirsutism; thickening of the skin, particularly over the fingers; and multiple, ivory-white, pebbly papules or nodules overlying the scapula and in the area of the posterior axillary fold. These nodules are most often localized symmetrically between the scapula angle and the linea axillaris posterior or on the thorax and the neck.
  • Papules with a pebbly appearance are a specific marker for the disease. These papules fade away through the digestion of a large amount of hyaluronic acid in cutaneous tissues by normal tissue histiocytes or enzymes of donor origin at an early stage after hematopoietic stem cell transplantation (SCT).⁸
  • Mongolian spots are observed at birth in 100% of Japanese, 96% of African American, 46% of the Hispanic, 9.5% of the white, 6.65% of Jewish, and 11.8% of Arab infants. They usually resolve and disappear by age 5-6 years. The most frequently involved region is the sacrococcygeal area, followed by gluteal and lumbar areas.^9,10
  • The brain MRI abnormalities in patients with mucopolysaccharidosis types I and II who have only mild clinical manifestations are abnormal signal intensity in the white matter, widening of the cortical sulci, the size of the supratentorial ventricles, dilatation of the perivascular spaces, and enlargement of the subarachnoid spaces.¹¹
  • Cerebral involvement is common. The increased myo-inositol-to-creatine (mI/Cr) ratio in patients with the neuronopathic form suggests the triggering of a glial response, and may be a surrogate marker of cerebral dysfunction in mucopolysaccharidosis II.
• The main findings of mucopolysaccharidosis type III (Sanfilippo syndrome) are regression of psychomotor development and neurologic signs (eg, hyperactivity, autistic features, behavioral disorder), which occur in children aged 2-6 years.
  • The sleep disruption in Sanfilippo syndrome consists of an irregular sleep/wake pattern, which at its onset might appear as a disorder of initiating or maintaining sleep. This could explain why some patients do not respond to conventional hypnotics.
  • Dysmorphic features are relatively rare.
  • Other signs include thickened facial features, coarse hair, genu valgum, and a short neck. Hirsutism is common.
  • Children become inattentive and deteriorate rapidly, losing the power of speech.
  • Mild hepatosplenomegaly is common.
  • The course of the disease is progressive; most patients die before age 20 years.
  • Osteoporosis and osteomalacia are possible skeletal effects. They probably result from nutritional deficiencies and the inability to walk, rather than from the genetic defect itself. Secondary skeletal involvement in patients with mucopolysaccharidosis type III may represent a considerable cause of morbidity and requires intervention to reduce the risk of pathological fractures.
  • The 4-point scoring system was arranged to classify patients into groups with a rapid or slower course of mucopolysaccharidosis type IIIA. Meyer et al performed the first systematic and comprehensive study on the natural course of the disease.¹²
    • In the cohort of patients with mucopolysaccharidosis type IIIA, the first symptoms of disease were observed, on average, at age 7 months.
    • Speech and motor development were delayed in 66.2% and 33.9% of patients, respectively.
    • The median age at diagnosis was 4.5 years.
    • The onset of regression in speech, motor, and cognitive function was observed at an average of age 3.3 years. The loss of all 3 of the assessed abilities was observed at an average of age 12.5 years. Speech was lost before motor and cognitive functions. In a small group of patients who were older than 12.5 years (9.9%), speech, motor, and cognitive skills were partially preserved up to a maximum of age 23.8 years.
    • The 4-point scoring system may have an important impact on parental counseling, as well as therapeutic interventions.
• Mucopolysaccharidosis type IV (Morquio syndrome) is characterized by abnormalities of the skeletal system (eg, kyphoscoliosis, pectus carinatum, luxation of the hips), aortic valvular disease, and dental abnormalities.
  • The clinical and radiographic appearances of the teeth resemble hypoplastic amelogenesis imperfecta with thin enamel of normal radiodensity.
  • Odontoid hypoplasia is common and can lead to deadly atlantoaxial instability if not treated.
  • Ophthalmologically, diffuse corneal opacification and alterations of the trabecular meshwork occasionally lead to glaucoma.
  • In Morquiolike syndrome, hearing deficits, dental abnormalities, cardiac murmurs, hepatomegaly, and joint laxity are absent.
• In mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome), the first clinical signs usually appear in the first 2 years of life and manifest as psychomotor retardation.
  • This syndrome resembles Hurler syndrome with typical facial changes.
  • Slowly, the thoracic deformity appears. Lumbar kyphosis, limited joint mobility, and a claw position of the hands are also present.
  • Usually, hepatosplenomegaly is present; less often, only splenomegaly is present.
  • Intelligence is usually normal, but visual and hearing impairments are present.
  • Compression of the spinal cord with successive neurologic complications can appear because of hypoplasia of the cervical vertebrae.
  • A large head, short neck, corneal opacity, open mouth associated with an enlarged tongue, enlargement of skull, and a long anteroposterior dimension are the main characteristic features.
  • Dental complications include unerupted dentition, dentigerous cystlike follicles, malocclusions, condylar defects, and gingival hyperplasia.¹³
  • Altered metabolism of GAGs in the extracellular matrix can contribute to the development of the left ventricular aneurysm.¹⁴
• Early after birth, children with mucopolysaccharidosis type VII have hepatosplenomegaly and facial deformities, such as hypertelorism, a prominent maxilla, and a depressed bridge of the nose.
  • Dwarfism with pectus carinatum and kyphosis is present.
  • Children have frequent upper respiratory tract infections.
  • Many develop corneal clouding.
  • Mental retardation is mild.
  • Craniovertebral instability and spinal cord compression can occur in persons with mucopolysaccharidosis type VII (Sly syndrome), with deposition of GAGs at the craniovertebral junction.¹⁵
  • A very rare finding is fetal hydrops.¹⁶

Causes

See Pathophysiology.

Differential Diagnoses

Niemann-Pick Disease
Syphilis

Other Problems to Be Considered

Hydrocephalus, rachitis, hypothyreosis, chondrodystrophia, and epiphyseal dysplasia (Normal thickening of diaphysis and tubular bones, irregular epiphyses, brachyspondylia, augmentation, and angulation of the spinal vertebrae are present in all these diseases.)

Osteogenesis imperfecta
Vitamin D–resistant rickets
Nephrogenic osteopathy
Syphilis connata
Spondyloepiphysial dysplasia
Metaphysial dysplasia

Workup

Laboratory Studies

• The diagnosis is based on the clinical picture, radiographic findings, and laboratory results.
• The diagnosis of mucopolysaccharidosis can be achieved by nonenzymatic screening methods, including the 2-dimensional electrophoresis method and the dimethylmethylene blue method.
  • The 2-dimensional electrophoresis method reveals separation of urinary GAGs, and the dimethylmethylene blue method can be used to estimate the concentration of GAG in urine. Both methods are specific, sensitive, and easy to perform for mucopolysaccharidosis screening.
  • Quantitation of urinary GAGs alone is not diagnostic of mucopolysaccharidosis; it should be coupled with qualitative analysis and enzyme estimations for differential/definitive diagnosis. Quantitation of isolated urinary GAGs can be performed using the acid Alcian blue complex formation method, and qualitative urinary GAG analysis can be performed by multisolvent sequential thin layer chromatography.¹⁷
  • Metachromatic granulations can be detected in the leukocytes in blood or bone marrow cells (Adler-Reilly granules containing GAGs).
• Measurement of iduronate-2-sulfatase (I2S) protein concentration with a 2-step, time-delayed, dissociation-enhanced lanthanide fluorescence immunoassay and enzyme activity with the fluorogenic substrate 4-methylumbelliferyl sulfate from the dried blood spots and plasma samples enables the detection of mucopolysaccharidosis type II.¹⁸

Imaging Studies

• Radiographic findings are as follows:
  • Mucopolysaccharidosis type II: Generalized symmetric damage of the epiphysis is noted. They are flattened and augmented. The metadiaphyseal parts of the tubular bones are shortened and thickened. Valgus deformity of the proximal parts of the femur and deformation of the plate bones are observed. Thickening of the ribs and shortening of the intercostal distance are noted. Platyspondylia of the columna vertebrarum with angle kyphosis in the lumbar and thoracic regions is evident. No changes are evident in the intervertebral spatia. The basis cranii is short; the sella turcica is flattened and prolonged. Blockage of the pneumatization and asymmetric osteogenesis are present.
  • Mucopolysaccharidosis type IV: Epiphyseal growth is disturbed. For the columna vertebrarum, platybrachyspondylia is characteristic. No disturbances are present in the intervertebral disks. In the thorax, the anteroposterior distance is augmented, while the intercostal distance is decreased.
• MRI is the primary imaging technique to detect CNS alterations. The presence of white matter alterations is significantly correlated with mental retardation. Other possible CNS alterations are perivascular, subarachnoid, and ventricular space enlargement and abnormalities of the basal ganglia, the corpus callosum, and the atlantoaxial joint.^19,20
• The release of GAG into the urine is currently used as a biomarker of disease, in some cases reflecting disease severity, and in all cases reflecting therapeutic responsiveness. Using RNA studies in 4 Italian patients undergoing enzyme replacement therapy, Di Natale et al observed that tumor necrosis factor-alpha might be a biomarker for mucopolysaccharidosis type VI that is responsive to therapy. In addition to its role as a potential biomarker, tumor necrosis factor-alpha expression could provide insights into the possible pathophysiological mechanisms underlying the mucopolysaccharidoses.²¹

Other Tests

• Carrier status can be determined by performing enzymatic assays in high-risk individuals.
• Prenatal diagnosis for most of these disorders is available to high-risk mothers, such as mothers of an affected offspring, who face a 25% chance of having another affected offspring in a subsequent pregnancy.
• In mucopolysaccharidosis type III, flash visual evoked potentials and brainstem auditory evoked potentials are almost always normal; electroencephalography findings are often abnormal early in the disease.²²
• Patients who present with progressive noninflammatory joint involvement in the first decade of life, particularly with stiffness of the fingers and difficulty using the hands, should be screened for metabolic diseases, including mucopolysaccharidosis type I.²³ Mucopolysaccharidosis type I should be considered if patients with arthropathy lack the typical characteristics of inflammatory arthropathy.
• Screening for vitreous abnormalities and maculopathy may be important in diagnosing, treating, and explaining visual loss in persons with Hunter syndrome.²⁴
• A new alpha-L-iduronidase substrate was synthesized to be used to assay the enzyme by use of tandem mass spectrometry together with an internal standard or by fluorometry. The assay uses a dried blood spot on a newborn screening card as the enzyme source. Tandem mass spectrometry assay has the potential to be adopted for newborn screening of mucopolysaccharidosis type I.²⁵
• The serum levels of heparin cofactor II–thrombin complex is a reliable biomarker of the mucopolysaccharidoses. Untreated patients have serum levels that range from 3- to 112-fold higher than control values. In a series of patients with varying severity of mucopolysaccharidosis type I, the serum complex concentration was reflective of disease severity.²⁶

Histologic Findings

In all types of mucopolysaccharidosis, normal or slightly thickened skin shows metachromatic granules within the fibroblasts by using Giemsa or toluidine blue staining. These metachromatic granules are occasionally evident within keratinocytes and eccrine structures. The characteristic cutaneous pebbling in Hunter syndrome shows these granules within the dermal fibroblasts and extracellular metachromatic material between the collagen bundles. In all types of mucopolysaccharidosis, the cytoplasm of circulating lymphocytes also demonstrates these granules. Patients with Morquio syndrome show reduced activity of N -acetyl-galactosamine-6-sulfatase on fibroblast culture obtained from a skin biopsy sample.

Treatment

Medical Care

No cure exists for mucopolysaccharidosis; current treatment is symptomatic and supportive. However, possible treatments are being investigated in several clinical trials.

Current therapies

In patients with mucopolysaccharidosis type I, treatment with recombinant human alpha-L-iduronidase reduces lysosomal storage in the liver and ameliorates some clinical manifestations of the disease.²⁷

In patients with mucopolysaccharidosis type I, laronidase significantly improves respiratory function and physical capacity, reduces GAG storage, and has a favorable safety profile.

A Hurler syndrome fibroblast cell line heterozygous for the IDUA gene that encodes alpha-L-iduronidase stop mutations Q70X or W402X shows a significant increase in alpha-L-iduronidase activity when cultured in the presence of gentamicin, resulting in the restoration of 2.8% of the normal alpha-L-iduronidase activity.

Allogeneic bone marrow transplantation (BMT) is the only long-lasting treatment that ameliorates or halts the aggressive course of the disease. Pulmonary hemorrhage is an unusual complication of BMT.²⁸

Allogeneic hematopoietic SCT, used in severe forms of the disease, markedly prolongs survival, alleviates ventricular hypertrophy, and preserves cardiac function, but cardiac valves continue to thicken and valvular insufficiency progresses.²⁹

Cell therapy with human amniotic epithelial cells was developed as an alternative method for enzyme replacement therapy in congenital lysosomal storage disorders, but only limited therapeutic efficacy has been reported. Some studies suggest that the transplantation of human amniotic epithelial cells transduced with adenoviral vectors can be used for the treatment of congenital lysosomal storage disorders. The multiple positive effects include reconstruction of the CNS.

Neonatal screening of these diseases should be mandatory to vastly improve outcomes. Plans are being implemented to use dried blood spots on filter paper, as is commonly performed for many other genetic diseases. Many new therapies are being adopted, which should enhance positivity and acceptance of treatment by hematopoietic SCT.

Many children who undergo SCT have deterioration in hearing following SCT. A high-risk group of children can be delineated who may benefit from more intensive audiologic monitoring following SCT.

For Maroteaux-Lamy syndrome, BMT is the only definitive form of enzyme replacement therapy available. Umbilical cord blood transplantation has also been reported as a treatment of this syndrome.

Therapy with glucocorticoids, high doses of vitamin A, thyroid hormone, lidase, and growth hormone has been attempted. Glucocorticoids and a corticotropin have been used to block the synthesis of acid mucopolysaccharides. High doses of vitamin A have been used in an effort to increase the urinary excretion of mucopolysaccharides; however, the amount excreted and the clinical response have varied. Lidase is a hyaluronidase that digests mucopolysaccharides. Thyroid hormone substitution is used in patients with hypothyroidism. Some patients with mucopolysaccharidosis are shown to have growth hormone deficiency, and in these cases, growth hormone therapy may be beneficial. Symptomatic anticonvulsive therapy is indicated when epilepsy is present. The prognosis is better and therapy is more successful when treatment is started early.

Treatment with recombinant human N -acetylgalactosamine 4-sulfatase (rhASB) is another possibility in mucopolysaccharidosis type VI. rhASB treatment reportedly was well-tolerated, and reduced lysosomal storage is evidenced by a dose-dependent reduction in urinary GAG.³⁰

Treatments in clinical trials

No cure exists for mucopolysaccharidosis; treatment is symptomatic and supportive. However, possible treatments are being investigated in several clinical trials.

Mucopolysaccharidosis type I

Laronidase (Aldurazyme) is an enzyme replacement therapy for patients with mucopolysaccharidosis type I, a progressive, debilitating, and fatal genetic disease for which specific drug treatments currently are available. In a press release in September 2002, BioMarin and Genzyme included clinical data from the 6-month, placebo-controlled, phase 3 trial of laronidase; 6 months of data from the ongoing open-label, phase 3 extension study; and 3 years of data from the phase 1 trial and extension study. Laronidase was approved in the United States in April 2003.

The study of a double-blinded, placebo-controlled trial reported by Muenzer et al supports the use of weekly infusions of idursulfase in the treatment of mucopolysaccharidosis type II.³¹ Idursulfase was generally well tolerated, but infusion reactions did occur. Idursulfase antibodies were detected in 46.9% of patients.^32,33

Mucopolysaccharidosis type II

In a press release from October 2002, Transkaryotic Therapies Inc (TKT) reported results from a phase 1/2 study evaluating its investigational enzyme replacement therapy with I2S as a treatment of Hunter syndrome. The randomized, double-blinded, placebo-controlled study evaluated the safety of I2S (human I2S produced by genetic engineering technology) and its clinical activity in 12 patients with Hunter syndrome. Three doses were studied (0.15 mg/kg, 0.5 mg/kg, and 1.5 mg/kg), and within each dose group, 3 patients were randomized to receive I2S and 1 was to receive placebo by a 60-min intravenous infusion biweekly for 6 months.

In the trial, I2S administration was generally well tolerated, and in the phase 1/2 trials, evidence of clinical activity with Hunter syndrome, including reduced cardiac mass, stabilized pulmonary function, and reduced GAG levels, was demonstrated. The most common adverse effects from I2S treatment were hives, chills, fever, and facial flushing. Only 1 of the 9 patients who were treated developed antibody to I2S.

Mucopolysaccharidosis type IV-A

BioMarin Pharmaceutical is developing a program to administer the missing enzyme galactose-6-sulfatase to individuals with mucopolysaccharidosis type IV-A. Studies in mucopolysaccharidosis types VI and VII animal models suggest that if given early, the enzyme can potentially change the outcome of bone and cartilage disease. Currently, no clinical trial is planned.

Mucopolysaccharidosis type VI

The clinical trial of rhASB (Aryplase), an investigational enzyme replacement therapy for mucopolysaccharidosis type VI, continues to evaluate the efficacy, safety, and pharmacokinetics of weekly intravenous infusions of 1 mg/kg of rhASB in 10 patients with mucopolysaccharidosis type VI. In June 2002, BioMarin Pharmaceutical announced findings from the 24-week open-label extension of the phase 1 clinical trial; the enzyme was well tolerated by all patients, and reduced urinary excretion of GAG was maintained in both treatment arms.³⁴

It was confirmed in the phase 3 of the randomized, double-blinded, placebo-controlled, multicenter, multinational study that rhASB significantly improves endurance, reduces urinary GAG excretion, and has an acceptable safety profile. After 24 weeks, patients receiving rhASB walked on average 92 meter more in the 12-minute walk test and climbed 5.7 stairs per minute more in a 3-minute stair climb test than patients receiving placebo. Urinary GAG declined by -227 ±18 mcg/mg more with rhASB than placebo. Patients exposed to the drug experienced positive clinical benefits despite the presence of antibody to the protein.

Mucopolysaccharidosis type VII

Emil Kakkis, MD, PhD, and William Sly, MD, have received a grant to develop enzyme replacement for mucopolysaccharidosis type VII. They are making steady progress with BioMarin Pharmaceutical, but no timeline for human clinical trials is projected.

Updated clinical trial data and recruiting

For updated clinical trial results and for trials that are completed and recruiting see ClinicalTrials.gov.

Surgical Care

Treatment is symptomatic. Surgical procedures may include corneal transplantation, correction of nerve entrapments in the hands, and heart valve replacement.

Correction of the contractures and osteal deformities may be performed. For patients with mucopolysaccharidosis type IV, cervical myelopathy should be prevented by surgery of the cervical spine.

Occipital to C3 decompression and fusion with autogenous rib grafts may be performed. The youngest patient who underwent this successful posterior cervical arthrodesis was 17-month-old boy with Sly syndrome.

Consultations

Genetic counseling is of great importance to ensure prenatal diagnosis.

Mucopolysaccharidoses create a special challenge for the otolaryngologist. With the rare types of mucopolysaccharidosis type IV and mucopolysaccharidosis type I-S, a skilled practitioner is required to manage airway complications. The erratic deposits of mucopolysaccharides throughout the trachea should be taken into account when a decision is made to stent the airway. Proper management requires an airway that is custom made to meet the patient's needs.

Medication

N- acetylgalactosamine-4-sulfatase is a recombinant human enzyme used to treat mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome). Most attempts at enzyme replacement in various forms of mucopolysaccharidosis have not been successful. Alpha-L-iduronidase is a recombinant human enzyme used to treat mucopolysaccharidosis type I that received US patent approval in November 2001 and was approved in April 2003 as a proprietary product. Laronidase (Aldurazyme), present in cell lysosomes, helps to break down mucopolysaccharides. In mucopolysaccharidosis type I patients, mucopolysaccharides accumulate in organs and tissues, particularly in the CNS, the liver, the spleen, the heart, and the skeleton. This accumulation leads to cell death and progressive tissue and organ damage.³⁵

Enzymes

Enzyme replacement therapy with laronidase may provide clinically important benefits (ie, improved pulmonary function and walking ability, reduced excess carbohydrates stored in organs).

Laronidase (Aldurazyme)

Indicated to treat MPS type I (Hurler syndrome, Scheie syndrome, Hurler-Scheie syndrome). Used to increase catabolism of GAGs, which accumulate with MPS type I. Treatment has shown to improve walking capacity and pulmonary function. Laronidase is a polymorphic variant of the human enzyme alpha-L-iduronidase produced by recombinant DNA technology.

Dosing

Adult

0.58 mg/kg IV qwk administered over 4 h; initiate at IV infusion rate of 10 mcg/kg/h and increase incrementally q15min as tolerated within first h; not to exceed 200 mcg/kg/h

Pediatric

<5 years: Not established
>5 years: Administer as in adults

Interactions

None reported

Contraindications

Documented hypersensitivity (consider risks and benefits of readministering drug following severe hypersensitivity reaction; exercise extreme care with appropriate resuscitation measures if decision is made to readminister product)

Precautions

Pregnancy

B - Fetal risk not confirmed in studies in humans but has been shown in some studies in animals

Precautions

Antibodies to laronidase develop by 12 wk; infusion-related hypersensitivity (eg, flushing, headache, rash, fever) reactions may occur (decreasing infusion rate or administering antihistamines may diminish symptoms)

Idursulfase (Elaprase)

Purified form of human I2S, a lysosomal enzyme. Hydrolyzes 2-sulfate esters of terminal iduronate sulfate residues from the GAGs dermatan sulfate and heparan sulfate in the lysosomes of various cell types. Indicated for MPS type II (Hunter syndrome) because replaces insufficient levels of the lysosomal enzyme I2S.

Dosing

Adult

0.5 mg/kg IV qwk; total volume typically infused over 1-3 h; initiate at rate of 8 mL/h for first 14 min; if tolerated, may increase by 8-mL/h increments q15min; not to exceed 100 mL/h

Pediatric

<5 years: Not established
>5 years: Administer as in adults

Interactions

None reported

Contraindications

Documented hypersensitivity

Precautions

Pregnancy

C - Fetal risk revealed in studies in animals but not established or not studied in humans; may use if benefits outweigh risk to fetus

Precautions

Anaphylactoid reactions have occurred (additional monitoring required, especially for individuals with respiratory compromise); appropriate medical support should be available during infusion, and premedication with antihistamines and/or corticosteroids recommended prior to infusion; common adverse effects include infusion-related reactions (eg, pyrexia, headache, arthralgia, pruritus, malaise, visual disturbance, musculoskeletal pain, urticaria)

Follow-up

Further Outpatient Care

All patients with mucopolysaccharidosis type I should receive a comprehensive baseline evaluation, including neurologic, ophthalmologic, auditory, cardiac, respiratory, gastrointestinal, and musculoskeletal assessments. Additionally, all patients should be monitored every 6-12 months with individualized specialty assessments, to monitor disease progression and effects of intervention. Patients are best treated by a multidisciplinary team. Treatments consist of palliative/supportive care, hematopoietic stem cell transplantation, and enzyme replacement therapy. The patient's age (>2 y or 2 y), predicted phenotype, and developmental quotient help define the risk-to-benefit profile for hematopoietic SCT transplantation (higher risk but can preserve CNS function) versus enzyme replacement therapy (low risk but cannot cross the blood-brain barrier).

Deterrence/Prevention

• Genetic counseling may be performed.
• Prenatal diagnosis is possible. Amniocentesis can be performed; cells in the amniotic fluid are cultured, and the alpha-L-iduronidase activity in the cells is determined.

Complications

• Mucopolysaccharidosis type I (Hurler syndrome): Complications include heart valve damage from thickening due to coronary artery disease, severe mental retardation, umbilical and inguinal hernia, deafness, premature death, and constipation alternating with diarrhea.
• Mucopolysaccharidosis type II (Hunter syndrome): Complications include airway obstruction in the late-onset form, progressive mental deterioration in the early-onset form (severe form), progressive loss of ability to perform daily living activities in the early-onset form (severe form), progressive hearing loss in both the mild and severe forms, progressive joint stiffness leading to contractures of the joints in the early-onset form (severe form), and carpal tunnel syndrome. Of the complications observed after tracheotomy, infrastomal tracheal stenosis and stomal narrowing are frequent.
• Mucopolysaccharidosis type III (Sanfilippo syndrome): Complications include blindness, seizures, mental retardation, progressive neurologic disease leading to patients becoming wheelchair bound, and the inability to care for oneself.
• Mucopolysaccharidosis type IV (Morquio syndrome): Complications include heart failure, difficulty with vision, walking problems due to abnormal curvature of the spine, and breathing problems. Abnormal neck bones can cause spinal cord damage that can result in severe disease, including paralysis, if not noticed early. Spinal fusion can prevent this complication.
• Mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome): Complications include hearing loss, vision loss, carpal tunnel syndrome, and valvular heart disease.

Prognosis

• Mucopolysaccharidosis type I (Hurler syndrome): Patients with Hurler syndrome have a poor prognosis. Children with this disease have significant progressive physical and mental deficiencies. Death can occur in late childhood, early adolescence, or adulthood.
• Mucopolysaccharidosis type II (Hunter syndrome): The life expectancy for the early-onset form (severe form) is 10-20 years; for the late-onset form (mild form), it is 20-60 years.
• Mucopolysaccharidosis type III (Sanfilippo syndrome): Severe retardation is the most important of the clinical problems. Patients may have IQs below 50. Severe cases lead to death before the patient is aged 20 years. In a minority of cases, it is compatible with a normal lifespan.
• Mucopolysaccharidosis type IV (Morquio syndrome): Bony abnormalities represent a significant problem. Small vertebrae at the top of the neck can cause slippage that damages the spinal cord, possibly resulting in paralysis. Death may occur as a result of cardiac complications.
• Mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome): The life expectancy is the second to third decade of life, with patients dying from heart failure. Patients may die earlier from cardiac or neurologic complications, depending on the severity of disease.

Patient Education

• The following Web sites are resources for patients and the medical community: The National MPS Society, National Organization for Rare Disorders, and National Tay-Sachs & Allied Diseases Association.

Miscellaneous

Special Concerns

• Within the first 3 months of pregnancy, intrauterine diagnosis is possible by analysis of the fibroblast culture obtained from amnionic fluid.

References

1. Hamano K, Hayashi M, Shioda K, Fukatsu R, Mizutani S. Mechanisms of neurodegeneration in mucopolysaccharidoses II and IIIB: analysis of human brain tissue. Acta Neuropathol. May 2008;115(5):547-59. [Medline].

2. Hrebicek M, Mrazova L, Seyrantepe V, et al. Mutations in TMEM76* cause mucopolysaccharidosis IIIC (Sanfilippo C syndrome). Am J Hum Genet. Nov 2006;79(5):807-19. [Medline].

3. Murphy AM, Lambert D, Treacy EP, O'Meara A, Lynch SA. Incidence and prevalence of mucopolysaccharidosis type 1 in the Irish republic. Arch Dis Child. Jan 2009;94(1):52-4. [Medline].

4. Malm G, Lund AM, Mansson JE, Heiberg A. Mucopolysaccharidoses in the Scandinavian countries: incidence and prevalence. Acta Paediatr. Nov 2008;97(11):1577-81. [Medline].

5. Ashrafi MR, Shabanian R, Mohammadi M, Kavusi S. Extensive Mongolian spots: a clinical sign merits special attention. Pediatr Neurol. Feb 2006;34(2):143-5. [Medline].

6. Panteliadis CP, Karatza ED, Tzitiridou MK, Koliouskas DE, Spiroglou KS. Lissencephaly and mongolian spots in Hurler syndrome. Pediatr Neurol. Jul 2003;29(1):59-62. [Medline].

7. Nemes A, Timmermans RG, Wilson JH, et al. The mild form of mucopolysaccharidosis type I (Scheie syndrome) is associated with increased ascending aortic stiffness. Heart Vessels. Mar 2008;23(2):108-11. [Medline].

8. Demitsu T, Kakurai M, Okubo Y, et al. Skin eruption as the presenting sign of Hunter syndrome IIB. Clin Exp Dermatol. May 1999;24(3):179-82. [Medline].

9. Sapadin AN, Friedman IS. Extensive Mongolian spots associated with Hunter syndrome. J Am Acad Dermatol. Dec 1998;39(6):1013-5. [Medline].

10. Ochiai T, Suzuki Y, Kato T, et al. Natural history of extensive Mongolian spots in mucopolysaccharidosis type II (Hunter syndrome): a survey among 52 Japanese patients. J Eur Acad Dermatol Venereol. Sep 2007;21(8):1082-5. [Medline].

11. Schwartz I, Vedolin L, Jardim LB, et al. Brain magnetic resonance imaging and spectroscopic findings inmucopolysaccharidosis type II. Acta Paediatrica. 2007;96:109-11.

12. Meyer A, Kossow K, Gal A, et al. Scoring evaluation of the natural course of mucopolysaccharidosis type IIIA (Sanfilippo syndrome type A). Pediatrics. Nov 2007;120(5):e1255-61. [Medline].

13. Alpoz AR, Coker M, Celen E, et al. The oral manifestations of Maroteaux-Lamy syndrome (mucopolysaccharidosis VI): a case report. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. May 2006;101(5):632-7. [Medline].

14. Oudit GY, Butany J, Williams WG, Siu SC, Clarke JT, Iwanochko RM. Left ventricular aneurysm in a patient with mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome): clinical and pathological correlation. Cardiovasc Pathol. Jul-Aug 2007;16(4):237-40. [Medline].

15. Dickerman RD, Colle KO, Bruno CA Jr, Schneider SJ. Craniovertebral instability with spinal cord compression in a 17-month-old boy with Sly syndrome (mucopolysaccharidosis type VII): a surgical dilemma. Spine. Mar 1 2004;29(5):E92-4. [Medline].

16. Venkat-Raman N, Sebire NJ, Murphy KW. Recurrent fetal hydrops due to mucopolysaccharidoses type VII. Fetal Diagn Ther. 2006;21(3):250-4. [Medline].

17. Gallegos-Arreola MP, Machorro-Lazo MV, Flores-Martinez SE, et al. Urinary glycosaminoglycan excretion in healthy subjects and in patients with mucopolysaccharidoses. Arch Med Res. Sep-Oct 2000;31(5):505-10. [Medline].

18. Dean CJ, Bockmann MR, Hopwood JJ, Brooks DA, Meikle PJ. Detection of mucopolysaccharidosis type II by measurement of iduronate-2-sulfatase in dried blood spots and plasma samples. Clin Chem. Apr 2006;52(4):643-9. [Medline].

19. Gabrielli O, Polonara G, Regnicolo L, et al. Correlation between cerebral MRI abnormalities and mental retardation in patients with mucopolysaccharidoses. Am J Med Genet A. Mar 15 2004;125A(3):224-31. [Medline].

20. Matheus MG, Castillo M, Smith JK, Armao D, Towle D, Muenzer J. Brain MRI findings in patients with mucopolysaccharidosis types I and II and mild clinical presentation. Neuroradiology. Aug 2004;46(8):666-72. [Medline].

21. Di Natale P, Villani GR, Parini R, et al. Molecular markers for the follow-up of enzyme-replacement therapy in mucopolysaccharidosis type VI disease. Biotechnol Appl Biochem. Mar 2008;49:219-23. [Medline].

22. Husain AM, Escolar ML, Kurtzberg J. Neurophysiologic assessment of mucopolysaccharidosis III. Clin Neurophysiol. Sep 2006;117(9):2059-63. [Medline].

23. Cimaz R, Vijay S, Haase C, et al. Attenuated type I mucopolysaccharidosis in the differential diagnosis of juvenile idiopathic arthritis: a series of 13 patients with Scheie syndrome. Clin Exp Rheumatol. Mar-Apr 2006;24(2):196-202. [Medline].

24. Anawis MA. Hunter syndrome (MPS II-B): a report of bilateral vitreous floaters and maculopathy. Ophthalmic Genet. Jun 2006;27(2):71-2. [Medline].

25. Blanchard S, Sadilek M, Scott CR, Turecek F, Gelb MH. Tandem mass spectrometry for the direct assay of lysosomal enzymes in dried blood spots: application to screening newborns for mucopolysaccharidosis I. Clin Chem. Dec 2008;54(12):2067-70. [Medline].

26. Randall DR, Colobong KE, Hemmelgarn H, et al. Heparin cofactor II-thrombin complex: a biomarker of MPS disease. Mol Genet Metab. Aug 2008;94(4):456-61. [Medline].

27. Braunlin EA, Berry JM, Whitley CB. Cardiac findings after enzyme replacement therapy for mucopolysaccharidosis type I. Am J Cardiol. Aug 1 2006;98(3):416-8. [Medline].

28. Gassas A, Sung L, Doyle JJ, Clarke JT, Saunders EF. Life-threatening pulmonary hemorrhages post bone marrow transplantation in Hurler syndrome. Report of three cases and review of the literature. Bone Marrow Transplant. Jul 2003;32(2):213-5. [Medline].

29. Grewal SS, Krivit W, Defor TE, et al. Outcome of second hematopoietic cell transplantation in Hurler syndrome. Bone Marrow Transplant. Mar 2002;29(6):491-6. [Medline].

30. Harmatz P, Whitley CB, Waber L, et al. Enzyme replacement therapy in mucopolysaccharidosis VI (Maroteaux-Lamy syndrome). J Pediatr. May 2004;144(5):574-80. [Medline].

31. Muenzer J, Wraith JE, Beck M, et al. A phase II/III clinical study of enzyme replacement therapy with idursulfase in mucopolysaccharidosis II (Hunter syndrome). Genet Med. Aug 2006;8(8):465-73. [Medline].

32. Wraith JE, Clarke LA, Beck M, et al. Enzyme replacement therapy for mucopolysaccharidosis I: a randomized, double-blinded, placebo-controlled, multinational study of recombinant human alpha-L-iduronidase (laronidase). J Pediatr. May 2004;144(5):581-8. [Medline].

33. Muenzer J, Wraith JE, Clarke LA. Mucopolysaccharidosis I: management and treatment guidelines. Pediatrics. Jan 2009;123(1):19-29. [Medline].

34. Harmatz P, Giugliani R, Schwartz I, et al. Enzyme replacement therapy for mucopolysaccharidosis VI: a phase 3, randomized, double-blind, placebo-controlled, multinational study of recombinant human N-acetylgalactosamine 4-sulfatase (recombinant human arylsulfatase B or rhASB) and follow-on, open-label extension study. J Pediatr. Apr 2006;148(4):533-539. [Medline].

35. Hein LK, Bawden M, Muller VJ, Sillence D, Hopwood JJ, Brooks DA. alpha-L-iduronidase premature stop codons and potential read-through in mucopolysaccharidosis type I patients. J Mol Biol. Apr 30 2004;338(3):453-62. [Medline].

36. Caillaud C, Poenaru L. Gene therapy in lysosomal diseases. Biomed Pharmacother. Oct 2000;54(10):505-12. [Medline].

37. Fu H, Samulski RJ, McCown TJ, Picornell YJ, Fletcher D, Muenzer J. Neurological correction of lysosomal storage in a mucopolysaccharidosis IIIB mouse model by adeno-associated virus-mediated gene delivery. Mol Ther. Jan 2002;5(1):42-9. [Medline].

38. Gosele S, Dithmar S, Holz FG, Volcker HE. [Late diagnosis of Morquio syndrome. Clinical histopathological findings in a rare mucopolysaccharidosis]. Klin Monatsbl Augenheilkd. Aug 2000;217(2):114-7. [Medline].

39. Ito K, Ochiai T, Suzuki H, Chin M, Shichino H, Mugishima H. The effect of haematopoietic stem cell transplant on papules with 'pebbly' appearance in Hunter's syndrome. Br J Dermatol. Jul 2004;151(1):207-11. [Medline].

40. Jeong HS, Cho DY, Ahn KM, Jin DK. Complications of tracheotomy in patients with mucopolysaccharidoses type II (Hunter syndrome). Int J Pediatr Otorhinolaryngol. Oct 2006;70(10):1765-9. [Medline].

41. Kakavanos R, Turner CT, Hopwood JJ, Kakkis ED, Brooks DA. Immune tolerance after long-term enzyme-replacement therapy among patients who have mucopolysaccharidosis I. Lancet. May 10 2003;361(9369):1608-13. [Medline].

42. Kakkis ED, Muenzer J, Tiller GE, et al. Enzyme-replacement therapy in mucopolysaccharidosis I. N Engl J Med. Jan 18 2001;344(3):182-8. [Medline].

43. Keeling KM, Brooks DA, Hopwood JJ, Li P, Thompson JN, Bedwell DM. Gentamicin-mediated suppression of Hurler syndrome stop mutations restores a low level of alpha-L-iduronidase activity and reduces lysosomal glycosaminoglycan accumulation. Hum Mol Genet. Feb 1 2001;10(3):291-9. [Medline].

44. Kim CH, Hwang HZ, Song SM, et al. Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations. Hum Mutat. Apr 2003;21(4):449-50. [Medline].

45. Krivit W. Allogeneic stem cell transplantation for the treatment of lysosomal and peroxisomal metabolic diseases. Springer Semin Immunopathol. Nov 2004;26(1-2):119-32. [Medline].

46. Lee V, Li CK, Shing MM, et al. Umbilical cord blood transplantation for Maroteaux-Lamy syndrome (mucopolysaccharidosis type VI). Bone Marrow Transplant. Aug 2000;26(4):455-8. [Medline].

47. Leighton SE, Papsin B, Vellodi A, Dinwiddie R, Lane R. Disordered breathing during sleep in patients with mucopolysaccharidoses. Int J Pediatr Otorhinolaryngol. Apr 27 2001;58(2):127-38. [Medline].

48. Mahalingam K, Janani S, Priya S, Elango EM, Sundari RM. Diagnosis of mucopolysaccharidoses: how to avoid false positives and false negatives. Indian J Pediatr. Jan 2004;71(1):29-32. [Medline].

49. Mariotti P, Della Marca G, Iuvone L, et al. Sleep disorders in Sanfilippo syndrome: a polygraphic study. Clin Electroencephalogr. Jan 2003;34(1):18-22. [Medline].

50. Mok A, Cao H, Hegele RA. Genomic basis of mucopolysaccharidosis type IIID (MIM 252940) revealed by sequencing of GNS encoding N-acetylglucosamine-6-sulfatase. Genomics. Jan 2003;81(1):1-5. [Medline].

51. Nelson J, Crowhurst J, Carey B, Greed L. Incidence of the mucopolysaccharidoses in Western Australia. Am J Med Genet A. Dec 15 2003;123A(3):310-3. [Medline].

52. Prystowsky SD, Maumenee IH, Freeman RG, Herndon JH Jr, Harrod MJ. A cutaneous marker in the Hunter syndrome a report of four cases. Arch Dermatol. May 1977;113(5):602-5. [Medline].

53. Punnett A, Bliss B, Dupuis LL, Abdolell M, Doyle J, Sung L. Ototoxicity following pediatric hematopoietic stem cell transplantation: a prospective cohort study. Pediatr Blood Cancer. Jun 2004;42(7):598-603. [Medline].

54. Rigante D, Caradonna P. Secondary skeletal involvement in Sanfilippo syndrome. QJM. Apr 2004;97(4):205-9. [Medline].

55. Ross CJ, Bastedo L, Maier SA, Sands MS, Chang PL. Treatment of a lysosomal storage disease, mucopolysaccharidosis VII, with microencapsulated recombinant cells. Hum Gene Ther. Oct 10 2000;11(15):2117-27. [Medline].

56. Sands MS, Barker JE, Vogler C, et al. Treatment of murine mucopolysaccharidosis type VII by syngeneic bone marrow transplantation in neonates. Lab Invest. Jun 1993;68(6):676-86. [Medline].

57. Schiro JA, Mallory SB, Demmer L, Dowton SB, Luke MC. Grouped papules in Hurler-Scheie syndrome. J Am Acad Dermatol. Nov 1996;35(5 Pt 2):868-70. [Medline].

58. Scriver RC, Beaudet AL, Sly WS. The Metabolic and Molecular Bases of Inherited Disease. New York, NY: McGraw-Hill; 1995.

59. Seyrantepe V, Tihy F, Pshezhetsky AV. The microcell-mediated transfer of human chromosome 8 restores the deficient N-acetylytransferase activity in skin fibroblasts of Mucopolysaccharidosis type IIIC patients. Hum Genet. Sep 2006;120(2):293-6. [Medline].

60. Shinhar SY, Zablocki H, Madgy DN. Airway management in mucopolysaccharide storage disorders. Arch Otolaryngol Head Neck Surg. Feb 2004;130(2):233-7. [Medline].

61. Weisstein JS, Delgado E, Steinbach LS, Hart K, Packman S. Musculoskeletal manifestations of Hurler syndrome: long-term follow-up after bone marrow transplantation. J Pediatr Orthop. Jan-Feb 2004;24(1):97-101. [Medline].

62. Whitley CB, Belani KG, Chang PN, et al. Long-term outcome of Hurler syndrome following bone marrow transplantation. Am J Med Genet. Apr 15 1993;46(2):209-18. [Medline].

63. Wolanczyk T, Banaszkiewicz A, Mierzewska H, Czartoryska B, Zdziennicka E. [Hyperactivity and behavioral disorders in Sanfilippo A (mucopolysaccharidosis type IIIA)--case report and review of the literature]. Psychiatr Pol. Sep-Oct 2000;34(5):831-7. [Medline].

Keywords

mucopolysaccharidosis, MPS, lysosomal storage disease, glycosaminoglycans, GAGs, MPS type I-H, Hurler syndrome, MPS type I-S, Scheie syndrome, MPS type V, MPS type I-H/S, Hurler-Scheie syndrome, MPS type II, Hunter syndrome, MPS type III-A, Sanfilippo syndrome type A, MPS III-B, Sanfilippo syndrome type B, MPS III-C, Sanfilippo syndrome type C, MPS type III-D, Sanfilippo syndrome type D, MPS type IV-A, Morquio syndrome, MPS type IV-B, MPS type VI, Maroteaux-Lamy syndrome, MPS type VII, Sly syndrome

Contributor Information and Disclosures

Author

Janette Baloghova, MD, PhD, Lecturer, Department of Dermatology, Medical Faculty, University of PJ Safarik at Kosice, Slovak Republic
Disclosure: Nothing to disclose.

Coauthor(s)

Robert A Schwartz, MD, MPH, Professor and Head, Dermatology, Professor of Pathology, Pediatrics, Medicine, and Preventive Medicine and Community Health, UMDNJ-New Jersey Medical School
Robert A Schwartz, MD, MPH is a member of the following medical societies: Alpha Omega Alpha, American Academy of Dermatology, American College of Physicians, and Sigma Xi
Disclosure: Nothing to disclose.

Zuzana Baranova, MD, PhD, Senior Lecturer, Department of Dermatology, University of PJ Safarik at Kosice, Slovak Republic
Disclosure: Nothing to disclose.

Medical Editor

Jacek C Szepietowski, MD, PhD, Professor, Vice-Head, Department of Dermatology, Venereology and Allergology, Wroclaw Medical University; Director of the Institute of Immunology and Experimental Therapy, Polish Academy of Sciences, Poland
Disclosure: Stiefel Salary Employment; Orfagen Consulting fee Consulting; Maruho Consulting fee Consulting; Astellas Consulting fee Consulting

Pharmacy Editor

David F Butler, MD, Professor of Dermatology, Texas A&M University College of Medicine; Chair, Department of Dermatology, Director, Dermatology Residency Training Program, Scott and White Clinic, Northside Clinic
David F Butler, MD is a member of the following medical societies: Alpha Omega Alpha, American Academy of Dermatology, American Medical Association, American Society for Dermatologic Surgery, American Society for MOHS Surgery, Association of Military Dermatologists, and Phi Beta Kappa
Disclosure: Nothing to disclose.

Managing Editor

Jeffrey J Miller, MD, Associate Professor of Dermatology, Penn State University College of Medicine; Staff Dermatologist, Penn State Milton S Hershey Medical Center
Jeffrey J Miller, MD is a member of the following medical societies: Alpha Omega Alpha, American Academy of Dermatology, Association of Professors of Dermatology, North American Hair Research Society, and Society for Investigative Dermatology
Disclosure: Nothing to disclose.

CME Editor

Catherine M Quirk, MD, Clinical Assistant Professor, Department of Dermatology, University of Pennsylvania
Catherine M Quirk, MD is a member of the following medical societies: Alpha Omega Alpha and American Academy of Dermatology
Disclosure: Nothing to disclose.

Chief Editor

Dirk M Elston, MD, Director, Department of Dermatology, Geisinger Medical Center
Dirk M Elston, MD is a member of the following medical societies: American Academy of Dermatology
Disclosure: Nothing to disclose.

The authors and editors of eMedicine gratefully acknowledge the contributions of previous author, Alexander Halagovec, MD, PhD, to the development and writing of this article.

© 1994- by Medscape.
All Rights Reserved
(http://www.medscape.com/public/copyright)