Mucopolysaccharidoses Types I-VII

GAGs are long, linear polysaccharide molecules composed of repeating dimers, each of which contains a hexuronic acid (or galactose in the case of keratan sulfate) and an amino sugar. The large proteoglycan molecules made up of protein cores, and GAG branches are secreted by cells and constitute a significant fraction of the extracellular matrix of connective tissue. The turnover of these molecules depends on their subsequent internalization by endocytosis, their delivery to the lysosomes, and their digestion by lysosomal enzymes. The enzyme deficiencies lead to the accumulation of mucopolysaccharides in the lysosomes of the cells in the connective tissue and to an increase in their excretion in the urine. The types of mucopolysaccharidoses linked to specific enzyme deficiencies are listed below; some have been assigned an Enzyme Commission (EC) number.

Table. Types of Mucopolysaccharidoses and Associated Enzyme Deficiencies (Open Table in a new window)

The enzyme synthesis is controlled at the following gene loci:

• 4p16.3 (Hurler syndrome, Scheie syndrome): The activity of alpha-L-iduronidase is decreased in Hurler syndrome and Scheie syndrome. However, Hurler syndrome is a severe form of the same heavy mucopolysaccharidosis, with affected children dying after several years, whereas Scheie disease has a mild clinical phenotype. In some populations, premature stop mutations represent roughly two thirds of the mutations that cause Hurler syndrome.

• 12q14 (Sanfilippo syndrome): The diagnosis requires a specific lysosomal enzyme assay for glucosamine (N -acetyl)-6-sulfatase (GNS) activity. A homozygous nonsense mutation is found in exon 9 (1063C --> T), which predicts premature termination of translation (R355X). In addition, 2 common synonymous coding single-nucleotide polymorphisms are found and genotyped in samples from 4 ethnic groups.

• 16q24.3 (Morquio syndrome): The deficiency of enzymes in Morquio syndrome type A or type B leads to the accumulation of keratan sulfate and chondroitin-6-sulfate in the connective tissue, the skeletal system, and the teeth.

• 5q11-q13 (Maroteaux-Lamy syndrome)

• Xq27.3-q28 (Hunter syndrome)

A new mutation has been reported, making a total of 15 different mutations that can cause premature stop codons in the alpha-L-iduronidase gene (IDUA), and the biochemistry of these mutations has been investigated. Natural stop codon read-through is dependent on the fidelity of the codon when evaluated at Q70X and W402X in CHO-K1 cells, but the 3 possible stop codons, TAA, TAG, and TGA, have different effects on mRNA stability, and this effect is context dependent.

In CHO-K1 cells expressing the Q70X and W402X mutations, the level of gentamicin-enhanced stop codon read-through is slightly less than the increment in activity caused by a lower-fidelity stop codon. In this system, gentamicin has more effect on read-through for the TAA and TGA stop codons compared with the TAG stop codon. In a mucopolysaccharidosis type I patient study, premature TGA stop codons were associated with a slightly attenuated clinical phenotype when compared with classic Hurler syndrome (eg, W402X/W402X and Q70X/Q70X genotypes with TAG stop codons). Natural read-through of premature stop codons is a potential explanation for the variable clinical phenotype in patients with mucopolysaccharidosis type I. Enhanced stop codon read-through is a potential treatment strategy for a large subgroup of patients with mucopolysaccharidosis type I.

In 25 Korean patients with Hunter syndrome, 20 mutations were identified, of which 13 mutations are novel: 6 small deletions (ie, 69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (ie, 21_22insG, 683_684insC), 2 terminations (ie, 529G>T, 637A>T), and 3 missense mutations (ie, 353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII restriction fragment length polymorphisms, 3 gene deletions were found. When the 20 mutations were depicted in a 3-dimensional model of iduronate 2 sulfatase protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas.

The candidate gene for mucopolysaccharidosis type IIIC has been localized to the pericentric region of chromosome 8 by linkage disequilibrium analysis.

Hamano et al[2] immunohistochemically examined the involvement of tauopathy/synucleinopathy, cell death, and oxidative damage in the brains of 3 cases each of mucopolysaccharidosis IIIB and mucopolysaccharidosis II and age-matched controls. In cases of mucopolysaccharidosis IIIB, the density of GABAergic interneurons in the cerebral cortex immunoreactive for calbindin-D28K and parvalbumin was markedly reduced compared with age-matched controls. The swollen neurons showed immunoreactivity for phosphorylated alpha-synuclein but not for phosphorylated tau protein or beta-amyloid protein; those in the cerebral cortex demonstrated nuclear immunoreactivity for TUNEL, single-stranded DNA and 8-OHdG. Neither lipid peroxidation nor protein glycation was marked in mucopolysaccharidosis cases. The expression levels of superoxide dismutases (Cu/ZnSOD and MnSOD) and glial glutamate transporters (EAAT1 and EAAT2) were reduced in 2 mucopolysaccharidosis II cases.

The disturbance of GABAergic interneurons can be related to mental disturbance, while synucleinopathy and/or DNA impairment may be implicated in the neurodegeneration of swelling neurons, owing to storage materials in mucopolysaccharidosis IIIB cases. These findings suggest the possibility of neuroprotective therapies other than enzyme replacement in mucopolysaccharidosis patients.[2]

The transmembrane protein gene TMEM76, which encodes a 73-kd protein with predicted multiple transmembrane domains and glycosylation sites, was found. Northern blot analysis identified 2 major TMEM76 transcripts of 4.5 kb and 2.1 kb ubiquitously expressed in various human tissues. The highest expression was detected in leukocytes and in heart, lung, placenta, and liver cells, whereas the gene was expressed at a much lower level in the thymus, colon, and brain, which is consistent with the expression patterns of lysosomal proteins. A total of 27 TMEM76 mutations were identified in the DNA of 30 mucopolysaccharidosis IIIC–affected families, which were not found in DNA from 105 controls.[3]

Functional expression of human TMEM76 and the mouse orthologue demonstrates that this gene encodes the lysosomal GNAT. Furthermore, it suggests that this enzyme belongs to a new structural class of proteins that transport the activated acetyl residues across the cell membrane.[3]

Oxidative stress may be involved in the pathophysiology of mucopolysaccharidosis type IV-A. A study of Donida et al describes an increase in oxidative damage to biomolecules (lipids, urine isoprostanes; proteins, urine di-Tyr and plasma sulfhydryl groups) and significant increases in basal DNA damage in mucopolysaccharidosis type IV-A patients.[4]

Frequency

The prevalences are as follows: mucopolysaccharidosis type I-H, 1-2 cases per 100,000 population; mucopolysaccharidosis type I-S, 1 case per 250,000 population; mucopolysaccharidosis type II, 1 case per 100,000 population; mucopolysaccharidosis type III, 1 case per 25,000-75,000 population; and mucopolysaccharidosis type IV, 1 case per 40,000-200,000 population.

The prevalences of mucopolysaccharidosis types VI, VII, and I-H/S are unknown, but the prevalence of mucopolysaccharidosis type I-H/S approximates that of mucopolysaccharidosis type I-S.

According to the US National Institutes of Health, studies in Canada estimate 1 in 100,000 babies born has Hurler syndrome. The estimate for Hurler-Scheie syndrome is 1 in 115,000, and for Scheie syndrome, it is 1 in 500,000.

An epidemiologic study of the mucopolysaccharidoses in Western Australia using multiple ascertainment sources was performed and the incidence rate for the period 1969-1996 was estimated. An incidence of approximately 1 case in 107,000 live births was obtained for mucopolysaccharidosis type I-H (Hurler phenotype); 1 case in 320,000 live births (1 in 165,000 male live births) for mucopolysaccharidosis type II (Hunter syndrome); 1 case in 58,000 for mucopolysaccharidosis III (Sanfilippo syndrome); 1 case in 640,000 for mucopolysaccharidosis type IV-A (Morquio syndrome type A); and 1 case in 320,000 for mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome). The overall incidence for all types of mucopolysaccharidosis was approximately 1 case in 29,000 live births.

Murphy et al estimated the incidence (2001-2006) and prevalence (2002 census) of mucopolysaccharidosis type I in the Irish Republic (AOl) using population data. The birth incidence was 1 case in 26,206 births, with a carrier frequency of 1 case in 81 births. Of note, 19 (73%) of 26 Hurler syndrome patients were Irish Travelers. Amongst Irish Travelers, the incidence was 1 case in 371 persons, with a carrier frequency of 1 case in 10 persons. This is the highest recorded incidence worldwide.[5]

According to the incidence study covered the period from 1975-2004 in Sweden and Denmark and from 1979-2004 in Norway, the incidence of all mucopolysaccharidosis disorders was 1.75 cases in Sweden, 3.08 cases in Norway, and 1.77 cases in Denmark per 100 000 newborns. The incidence of mucopolysaccharidosis type I was the most common in all 3 countries, with 0.67, 1.85, and 0.54 cases per 100 000 newborns, respectively; for mucopolysaccharidosis type II, numbers were 0.27, 0.13, and 0.27 cases, respectively. For patients with other mucopolysaccharidosis disorders, the incidence varied widely. The prevalence for all mucopolysaccharidosis disorders was 4.24, 7.06, and 6.03 cases per million inhabitants in Sweden, Norway, and Denmark, respectively.[6]

Héron et al in the retrospective epidemiological study in France, the United Kingdom, and Greece calculated the incidence according to the number of patients born each year and then diagnosed with mucopolysaccharidosis type III before 2006. A comparison between countries focused on years 1990-1994. The calculated incidence of mucopolysaccharidosis type III in France (0.68 case per 100,000 live-births) was almost half that in the United Kingdom (1.15 cases per 100,000). Prevalence in Greece (0.97 case per 100,000 live-births) was in between France and the United Kingdom. However, mucopolysaccharidosis type IIIA was not diagnosed in Greece, and mucopolysaccharidosis type IIIB was the most highly prevalent type.[7]

Age

Onset usually occurs in early childhood.

Patients with Hurler syndrome usually die by age 5-10 years. The life expectancy of patients with Scheie syndrome may be nearly normal. They can live until the fifth or sixth decade of life, and they can have healthy offspring. As for patients with Hunter and Sanfilippo syndromes, death usually occurs by the time of puberty. In the classic form of Morquio syndrome, long-term survival is rare, with death occurring in persons aged 20-40 years. In patients with the severe form of Maroteaux-Lamy syndrome, death usually occurs by early adulthood.

Mucopolysaccharidosis type I (Hurler syndrome)

Patients with Hurler syndrome have a poor prognosis. Children with this disease have significant progressive physical and mental deficiencies. Death can occur in late childhood, early adolescence, or adulthood.

Mucopolysaccharidosis type II (Hunter syndrome)

The life expectancy for the early-onset form (severe form) is 10-20 years; for the late-onset form (mild form), it is 20-60 years.

Mucopolysaccharidosis type III (Sanfilippo syndrome)

Severe retardation is the most important of the clinical problems. Patients may have IQs below 50. Severe cases lead to death before the patient is aged 20 years. In a minority of cases, it is compatible with a normal lifespan.

Mucopolysaccharidosis type IV (Morquio syndrome)

Bony abnormalities represent a significant problem. Small vertebrae at the top of the neck can cause slippage that damages the spinal cord, possibly resulting in paralysis. Death may occur as a result of cardiac complications.

Mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome)

The life expectancy is the second to third decade of life, with patients dying from heart failure. Patients may die earlier from cardiac or neurologic complications, depending on the severity of disease.

Mucopolysaccharidosis type VII (Sly syndrome)

In mild cases, patients were reported to survive to age 19-20 years. Life expectancy is reduced as a result of frequent upper respiratory tract infections, neurodegenerative complications, and gastrointestinal tract abnormalities.

Mucopolysaccharidosis usually manifests during infancy or early childhood.

The organs most involved include bone, the viscera, connective tissue, and the brain.

Dysostosis multiplex denotes the characteristic bony abnormalities.

Hepatosplenomegaly is a frequent finding.

Coarse facies, retinal disease, deafness, cardiovascular anomalies, and neurologic abnormalities can be present.

Common cutaneous findings are lichenified, dry, thick skin with diminished elasticity; increased pigmentation on the dorsum of the hands; sclerodermalike changes; hypertrichosis of the extremities; pale-colored hair; and alopecia areata.

Obstructive sleep apnea reportedly is a finding in children with mucopolysaccharidoses. Obstructive respiratory problems are common in patients with mucopolysaccharidosis. The severity of obstructive sleep apnea varies with each type of mucopolysaccharidosis.

Tonsillar hypertrophy is a typical symptom in patients with mucopolysaccharidoses. Early disease-specific treatment before the development of irreversible damage (ie, fibrosis of heart valves) should result in an improved outcome no matter what type of treatment. An early diagnosis is critical for the success of this therapy and can be realized by qualified histological examination.[8] The accumulation of glycosaminoglycans in the vocal source leading to unbalanced enlargement can exhibit pathological jitter and shimmer. This reduced rate of syllable vocalization may be explained by the enlarged lips and tongues, which may impede their rapid repetition of consonant-vowel syllables. Mixed hearing loss (conductive and sensorineural) can be also present.[9]

Severe neurologic deficits and mental retardation are frequently associated with disrupted ganglioside metabolism in a variety of gangliosidoses and lysosomal storage disorders.

All types of mucopolysaccharidoses are linked with thickened and inelastic-appearing skin. Mucopolysaccharidosis type II (Hunter syndrome) reportedly is the only type with distinctive cutaneous findings; ivory-white papules or nodules 3-4 mm in diameter are present on the trunk, sometimes in a reticulate pattern. However, grouped skin-colored papules were described in a 5-year-old boy with Hurler-Scheie syndrome.

Children with mucopolysaccharidosis are usually characterized by short stature, mainly a short trunk; lower values referring to head and neck height, shoulder, and hip breadth; and a higher degree of adiposity.[10]

Results of a study of Bradley et al revealed worsening linear growth over time in individuals with mucopolysaccharidosis type II and type VI and significantly elevated body mass index standard deviation score. The elevated body mass index in individuals with mucopolysaccharidosis is a risk factor for long-term cardiovascular disease.[11]

Mucopolysaccharidosis type I-H (Hurler syndrome)

The onset of mucopolysaccharidosis type I-H (Hurler syndrome) occurs in early childhood (ie, 6-12 mo).

The skin is thickened and inelastic, as in other mucopolysaccharidoses. Hypertrichosis is common. Grouped skin-colored papules were described in 1 child with Hurler-Scheie syndrome.

Findings of generalized mongolian spots have been reported in newborns, which can lead to early detection and early treatment.[12, 13]

Neurologic symptoms include hypertensive hydrocephalus syndrome, changes in the tonus of the musculature and the tendon reflex, and damage of the cranial nerves.

Myxedema may occur in patients with associated hypothyroidism.

Skeletal findings include dwarfism, with rather characteristic radiologic changes of the hands and the lumbar vertebral column; lumbar gibbus; stiff articulations; coarse facies; hip dysplasia; genu valgum; spine abnormalities; and hand abnormalities.

Other findings include hepatosplenomegaly and cardiovascular involvement. The cardiovascular findings include cardiac murmurs at the end of the second year and valvular heart disease; coronary artery insufficiency and peripheral vascular insufficiency are late findings. Fatal cardiomyopathy with autopsy-confirmed endocardial fibroelastosis has been reported.

CNS signs include progressive deterioration of intellect after a period of apparently normal development, debility, and speech disturbances. CNS lesions include lissencephaly, excessive ventricular enlargement and Dandy-Walker malformation with vermis atrophy, and cerebellar cysts. The association with lissencephaly is rare. The combination of mongolian spots and severe CNS lesions in Hurler syndrome is considered a rare clinical occurrence.

Ocular symptoms include progressive clouding of the cornea, megalocornea, hereditary glaucoma, and congestion and atrophy of the optic disc.

Mucopolysaccharidosis type I-S (Scheie syndrome)

Mucopolysaccharidosis type I-S (Scheie syndrome) usually occurs in persons aged 5-15 years.

Skeletal findings include mild skeletal deformation and deformity of the hands. Growth may be normal.

Aortic stenosis or regurgitation may be present. Mucopolysaccharidosis IS patients have an impairment of ascending aortic elasticity. Measured with transthoracic echocardiography in mucopolysaccharidosis IS patients, aortic stiffness index was significantly increased, while aortic distensibility was significantly decreased compared with age- and sex-matched controls. Further follow-up studies are needed to examine arterial elasticity using other methods in this patient population and to detect possible effects of enzyme replacement therapy.[14]

Hepatosplenomegaly may be present.

Intelligence is usually normal.

The clinical signs of mucopolysaccharidosis type I-H/S (Hurler-Scheie syndrome) begin in persons aged 2-4 years; the signs are the same as those of mucopolysaccharidosis type I-H, but they are milder with a slower progression.

Mucopolysaccharidosis type II (Hunter syndrome)

Mucopolysaccharidosis type II (Hunter syndrome) manifests in persons aged 1-3 years.

Clouding of the cornea does not occur, although patients have a pigmentary change in the ocular fundus with diminution of visual acuity and deposits of mucopolysaccharides.

Lumbar gibbus is rare in persons with Hunter syndrome.

Progressive deafness is a major problem. This also occurs in persons with Hurler syndrome, but severe mental retardation and early death make it a relatively inconspicuous feature.

Hepatosplenomegaly, stiff articulations, coarse facial features, and cardiovascular involvement occur as in Hurler syndrome.

Cutaneous manifestations include hirsutism; thickening of the skin, particularly over the fingers; and multiple, ivory-white, pebbly papules or nodules overlying the scapula and in the area of the posterior axillary fold. These nodules are most often localized symmetrically between the scapula angle and the linea axillaris posterior or on the thorax and the neck.

Papules with a pebbly appearance are a specific marker for the disease. These papules fade away through the digestion of a large amount of hyaluronic acid in cutaneous tissues by normal tissue histiocytes or enzymes of donor origin at an early stage after hematopoietic stem cell transplantation (SCT).[15]

Mongolian spots are observed at birth in 100% of Japanese, 96% of African American, 46% of the Hispanic, 9.5% of the white, 6.65% of Jewish, and 11.8% of Arab infants. They usually resolve and disappear by age 5-6 years. The most frequently involved region is the sacrococcygeal area, followed by gluteal and lumbar areas.[16, 17]

The brain MRI abnormalities in patients with mucopolysaccharidosis types I and II who have only mild clinical manifestations are abnormal signal intensity in the white matter, widening of the cortical sulci, the size of the supratentorial ventricles, dilatation of the perivascular spaces, and enlargement of the subarachnoid spaces.[18]

Cerebral involvement is common. The increased myo-inositol-to-creatine (mI/Cr) ratio in patients with the neuronopathic form suggests the triggering of a glial response, and may be a surrogate marker of cerebral dysfunction in mucopolysaccharidosis II.

Carpal tunnel syndrome (CTS) is very common (85-96%) in patients with Hunter syndrome, and it starts in very early childhood, as early as age 26 months.[19]

Neonatal respiratory distress is more frequent in patients with mucopolysaccharidosis type II than in the general population. This may reflect airway disease already present in this disorder at the time of birth. The literature suggests that respiratory distress from any cause may occur in as many of 4-5% of term infants, whereas in the study of Dodsworth et al, it was observed in 32% of 34 infants with mucopolysaccharidosis type II.[20]

Mucopolysaccharidosis type III (Sanfilippo syndrome)

The main findings of mucopolysaccharidosis type III (Sanfilippo syndrome) are regression of psychomotor development and neurologic signs (eg, hyperactivity, autistic features, behavioral disorder), which occur in children aged 2-6 years. More developmental delay can be misdiagnosed as autism spectrum disorder or idiopathic developmental delay.[21]

The sleep disruption in Sanfilippo syndrome consists of an irregular sleep/wake pattern, which at its onset might appear as a disorder of initiating or maintaining sleep. This could explain why some patients do not respond to conventional hypnotics.

Dysmorphic features are relatively rare.

Other signs and symptoms include thickened facial features, coarse hair, genu valgum, short neck, frequent ear and upper respiratory tract infections, and hearing loss. Hirsutism is common.

Children become inattentive and deteriorate rapidly, losing the power of speech.

Mild hepatosplenomegaly is common.

Osteoporosis and osteomalacia are possible skeletal defects. They probably result from nutritional deficiencies and the inability to walk, rather than from the genetic defect itself. Secondary skeletal involvement in patients with mucopolysaccharidosis type III may represent a considerable cause of morbidity and requires intervention to reduce the risk of pathological fractures. Orthopedic manifestations (scoliosis, lumbar lordosis, kyphosis, hip dysplasia and pain, trigger digits, carpal tunnel syndrome, joint contractures) appear only in a minority of patients.[21]

The course of the disease is progressive; most patients die before age 20 years.

The 4-point scoring system was arranged to classify patients into groups with a rapid or slower course of mucopolysaccharidosis type IIIA. Meyer et al performed the first systematic and comprehensive study on the natural course of the disease.[22]

In the cohort of patients with mucopolysaccharidosis type IIIA, the first symptoms of disease were observed, on average, at age 7 months. Speech and motor development were delayed in 66.2% and 33.9% of patients, respectively. The median age at diagnosis was 4.5 years. The onset of regression in speech, motor, and cognitive function was observed at an average of age 3.3 years. The loss of all 3 of the assessed abilities was observed at an average of age 12.5 years. Speech was lost before motor and cognitive functions. In a small group of patients who were older than 12.5 years (9.9%), speech, motor, and cognitive skills were partially preserved up to a maximum of age 23.8 years.

The 4-point scoring system may have an important impact on parental counseling, as well as therapeutic interventions.

Mucopolysaccharidosis type IV (Morquio syndrome)

Mucopolysaccharidosis type IV (Morquio syndrome) is characterized by abnormalities of the skeletal system (eg, kyphoscoliosis, pectus carinatum, luxation of the hips), aortic valvular disease, and dental abnormalities. See the images below.

The clinical and radiographic appearances of the teeth resemble hypoplastic amelogenesis imperfecta with thin enamel of normal radiodensity.

Odontoid hypoplasia is common and can lead to deadly atlantoaxial instability if not treated.

Ophthalmologically, diffuse corneal opacification and alterations of the trabecular meshwork occasionally lead to glaucoma.

In Morquiolike syndrome, hearing deficits, dental abnormalities, cardiac murmurs, hepatomegaly, and joint laxity are absent.

Mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome)

In mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome), the first clinical signs usually appear in the first 2 years of life and manifest as psychomotor retardation.

This syndrome resembles Hurler syndrome with typical facial changes including frontal bossing, a depressed nasal bridge, open mouth associated with enlarged tongue, gingival hypertrophy, delayed dental eruption, and hypertrichosis.[23]

A large head, short neck, corneal opacity, an enlarged tongue, enlargement of skull, and a long anteroposterior dimension are the main characteristic features.

Slowly, the thoracic deformity appears. Lumbar kyphosis, limited joint mobility, and a claw position of the hands are also present.

Usually, hepatosplenomegaly is present; less often, only splenomegaly is present.

Intelligence is usually normal, but visual and hearing impairments are present.

Compression of the spinal cord with successive neurologic complications can appear because of hypoplasia of the cervical vertebrae.

Growth often slows after the first year of life, with complete cessation at age 3-4 years. Adult height is generally less than 120 cm.[23]

Dental complications include unerupted dentition, dentigerous cystlike follicles, malocclusions, condylar defects, and gingival hyperplasia.[24]

Altered metabolism of GAGs in the extracellular matrix can contribute to the development of the left ventricular aneurysm.[25]

Patients older than 10 years may progress to severe pulmonary obstruction and respiratory failure requiring tracheostomy, cardiac valve regurgitation or stenosis requiring valve replacement, severe joint disease (especially of the hips), claw-hand deformities secondary to flexion contractures and carpal tunnel disease, severe spinal kyphosis, scoliosis, and cervical stenosis with spinal cord compression.[23]

Okamura et all reported a case of a 7-year-old Mongolian boy with a novel homozygous missense mutation, c.278 C>T, p.P93L, who had extensive large Mongolian spots on his back.[26] . Diffuse dermal melanocytosis, which is not common in mucopolysaccharidosis type VI, was also reported in a case of a 4-year-old girl. The faint gray lesion were presented on her back, shoulders, and buttocks from birth.[27]

Mucopolysaccharidosis type VII

Early after birth, children with mucopolysaccharidosis type VII have hepatosplenomegaly and facial deformities, such as hypertelorism, a prominent maxilla, and a depressed bridge of the nose.

Dwarfism with pectus carinatum and kyphosis is present.

Children have frequent upper respiratory tract infections.

Many develop corneal clouding.

Mental retardation is mild.

Craniovertebral instability and spinal cord compression can occur in persons with mucopolysaccharidosis type VII (Sly syndrome), with deposition of GAGs at the craniovertebral junction.[28]

A very rare finding is fetal hydrops.[29] It is the most severe form of mucopolysaccharidosis type VII and is always fatal. Ultrasound findings include generalized edema, ascites, hydrothorax, pericardial effusion, and increased nuchal translucency. Milder forms may present with symptoms at birth or within the first years of life, with coarse facies, hepatosplenomegaly, umbilical or inguinal herniae, recurrent respiratory infections, developmental delay, and multiple skeletal abnormalities known as dysostosis multiplex.[30]

Ocular manifestations of mucopolysaccharidoses

Corneal clouding is a very common feature of mucopolysaccharidosis types IH,IH/S, VI, and VII (Sly syndrome), but it can also occur in the other mucopolysaccharidosis types.

Moderate-to-severe retinopathy has been reported for patients with mucopolysaccharidosis type I (all subtypes), mucopolysaccharidosis type II, mucopolysaccharidosis type III, and mucopolysaccharidosis type IV (Morquio syndrome).

Open-angle and acute and chronic closed-angle glaucoma have been observed in almost all mucopolysaccharidosis type but are most severe in mucopolysaccharidosis type IH, mucopolysaccharidosis type IH/S and mucopolysaccharidosis type VI.

Optic disc swelling and optic nerve atrophy may occur in all mucopolysaccharidosis types but most commonly affect patients with mucopolysaccharidosis type I and mucopolysaccharidosis type VI. About half of the patients with mucopolysaccharidosis type IH, mucopolysaccharidosis type IH/S and mucopolysaccharidosis type VI have swollen optic discs.[31]

Cardiac abnormalities of mucopolysaccharidoses

In the study by Lin et al, 27 (96%) of 28 Taiwanese patients with mucopolysaccharidosis types I, II, IV-A, or VI had abnormal cardiac geometric features, including 57% with asymmetric septal hypertrophy, 46% with mitral valve prolapse, and 46% with diastolic dysfunction. They reported the effects of enzyme replacement therapy on cardiac structure and function. Enzyme replacement therapy appears to be effective in reducing intraventricular septal hypertrophy, and it may have better results when started at a younger age; however, it seemed to have little or no effect on valvular heart disease.[32]

Gniadek et al found changes that are consistent with, but expand on, the original description of Sly syndrome (mucopolysaccharidosis type VII) and appear to be typical of other mucopolysaccharidoses. The involvement of the coronary arteries and coronary arterioles suggests a combination of the features seen in mucopolysaccharidosis types I and II (large artery thickening with intimal proliferation), as well as mucopolysaccharidosis type VI (coronary arteriole intimal proliferation).[33]

Spinal involvement in mucopolysaccharidoses

Spinal involvement is common in patients with mucopolysaccharidosis type IV-A (Morquio A syndrome), type VI (Maroteaux-Lamy syndrome), type I (Hurler syndrome), type II (Hunter syndrome), type III (Sanfilippo syndrome), and VII (Sly syndrome). This includes musculoskeletal abnormalities such as dysostosis multiplex, flattening and elongation (platyspondyly) of the vertebral bodies, and wedge-shaped vertebral bodies with anterior beaking, resulting thoracolumbar kyphosis or even gibbus deformity and odontoid dysplasia. Spinal stenosis, which mainly results from focal or multilevel thickening of the connective tissues within the central spinal canal, particularly of the meninges, posterior longitudinal ligament, and flaval ligaments, is due to GAG deposition. Spinal cord compression may involve multiple spinal cord levels, but usually the craniocervical junction and thoracolumbar spine. It can be related to central spinal canal stenosis due to GAG deposits in the periodontoid tissue, supporting ligaments, and meninges, or to vertebral abnormalities, dysplasia of the odontoid process, ligamentous laxity, and invagination of the posterior arch of Atlas, leading to atlantoaxial subluxation and instability.[34]

The diagnosis is based on the clinical picture, radiographic findings, and laboratory results.

The diagnosis of mucopolysaccharidosis can be achieved by nonenzymatic screening methods, including the 2-dimensional electrophoresis method and the dimethylmethylene blue method. The 2-dimensional electrophoresis method reveals separation of urinary GAGs, and the dimethylmethylene blue method can be used to estimate the concentration of GAG in urine. Both methods are specific, sensitive, and easy to perform for mucopolysaccharidosis screening. Quantitation of urinary GAGs alone is not diagnostic of mucopolysaccharidosis; it should be coupled with qualitative analysis and enzyme estimations for differential/definitive diagnosis. Quantitation of isolated urinary GAGs can be performed using the acid Alcian blue complex formation method, and qualitative urinary GAG analysis can be performed by multisolvent sequential thin layer chromatography.[35]  Metachromatic granulations can be detected in the leukocytes in blood or bone marrow cells (Adler-Reilly granules containing GAGs).

Measurement of iduronate-2-sulfatase (I2S) protein concentration with a 2-step, time-delayed, dissociation-enhanced lanthanide fluorescence immunoassay and enzyme activity with the fluorogenic substrate 4-methylumbelliferyl sulfate from the dried blood spots and plasma samples enables the detection of mucopolysaccharidosis type II.[36]

The release of GAG into the urine is used as a biomarker of disease, in some cases reflecting disease severity, and in all cases reflecting therapeutic responsiveness. Using RNA studies in 4 Italian patients undergoing enzyme replacement therapy, Di Natale et al observed that tumor necrosis factor-alpha might be a biomarker for mucopolysaccharidosis type VI that is responsive to therapy. In addition to its role as a potential biomarker, tumor necrosis factor-alpha expression could provide insights into the possible pathophysiological mechanisms underlying the mucopolysaccharidoses.[37]

A new alpha-L-iduronidase substrate was synthesized to be used to assay the enzyme by use of tandem mass spectrometry together with an internal standard or by fluorometry. The assay uses a dried blood spot on a newborn screening card as the enzyme source. Tandem mass spectrometry assay has the potential to be adopted for newborn screening of mucopolysaccharidosis type I.[38]

The serum levels of heparin cofactor II–thrombin complex is a reliable biomarker of the mucopolysaccharidoses. Untreated patients have serum levels that range from 3- to 112-fold higher than control values. In a series of patients with varying severity of mucopolysaccharidosis type I, the serum complex concentration was reflective of disease severity.[39]

Study of Dung et al provided evidence of extensive allelic heterogeneity of mucopolysaccharidosis type IVA. The urine GAGs are within normal limits in 10-20% of patients. If mucopolysaccharidosis type IVA is clinically suspected, the assay for keratan sulfate in blood and urine is preferable, followed by GALNS (N -acetylgalactosamine-6-sulfate sulfatase) enzyme assay in peripheral leukocytes or fibroblasts.[40]

Radiography

In mucopolysaccharidosis type II, generalized symmetric damage of the epiphysis is noted. They are flattened and augmented. The metadiaphyseal parts of the tubular bones are shortened and thickened. Valgus deformity of the proximal parts of the femur and deformation of the plate bones are observed. Thickening of the ribs and shortening of the intercostal distance are noted. Platyspondylia of the columna vertebrarum with angle kyphosis in the lumbar and thoracic regions is evident. No changes are evident in the intervertebral spatia. The basis cranii is short; the sella turcica is flattened and prolonged. Blockage of the pneumatization and asymmetric osteogenesis are present.

In mucopolysaccharidosis type IV, epiphyseal growth is disturbed. For the columna vertebrarum, platybrachyspondylia is characteristic. No disturbances are present in the intervertebral disks. In the thorax, the anteroposterior distance is augmented, while the intercostal distance is decreased.

Characteristic radiological findings of mucopolysaccharidosis VI, other mucopolysaccharidoses, mucolipidoses, and other storage diseases are termed dysostosis multiplex. Typical radiological findings include thickened, short metacarpal bones with proximal pointing and thin cortices; carpal bones that are irregular and hypoplastic and tarsal bones that have irregular contours; a dysplastic femoral head; severe hip dysplasia; abnormal development of vertebral bodies of the spine; paddle-shaped widened ribs and short, thick irregular clavicles, hypoplastic distal ulna and radius; thickened diploic space; and abnormally shaped J-shaped sella in the cranium. Slowly progressing mucopolysaccharidosis type VI patients may not demonstrate all the above characteristics of dysostosis multiplex.[23]

Radiographic features of oral and maxillofacial manifestations in patients with mucopolysaccharidoses can involve taurodontism, enamel hypoplasia, enlarged cystlike dental crypts, microdont third molars and supernumerary teeth (forth molars), enlargement of bone marrow and thinning of cortical bone related to the accumulation of mucopolysaccharides in the bone tissues of the jaws, and irregularities of the condyle, characterized as excessive wear and erosions in the surface of the condyle and teeth impaction.[41]

Magnetic resonance imaging (MRI)

MRI is the primary imaging technique to detect CNS alterations. The presence of white matter alterations is significantly correlated with mental retardation. Other possible CNS alterations are perivascular, subarachnoid, and ventricular space enlargement and abnormalities of the basal ganglia, the corpus callosum, and the atlantoaxial joint.[42, 43]

Brain atrophy usually develops earlier in mucopolysaccharidosis types I, II, III, and VII, becoming visible during the first few years of life. Patients with mucopolysaccharidosis types IV and VI typically have normal intelligence and do not show signs of atrophy until the second decade of life. The atrophy of the brain is seen as widened subarachnoid spaces and enlargement of the cortical sulci. The MRI evaluation of these findings is a useful marker of axonal loss.[44]

Magnetic resonance spectroscopy (MRS)

MRS is a noninvasive imaging technique able to provide information about tissue molecular structures. Some studies have suggested a contribution of MRS to mucopolysaccharidoses assessment (a reduction of the white matter N -acetylaspartate/creatine [NAA/Cr] ratio in mucopolysaccharidosis types IVA and II proportional to cognitive indices and to disease progression, an elevated myo-inositol/creatine [mIns/Cr] ratio in patients with cognitive impairment, a reduction in mucopolysaccharides in white matter without lesions after bone marrow transplantation, and correlation between mucopolysaccharide accumulation and neuronal damage). The future will show the significance of MRS in the evaluation of neurological involvement in mucopolysaccharidoses.[44]

CT scanning

A thickened, retracted tympanic membrane and increased attenuation of the tympanic cavity and mastoid cells can be observed on multidetector computed tomography (MDCT) images. Multiplanar reconstruction of a MDCT scan, usually performed for the evaluation of the atlantoaxial instability, may be an important tool to assess the status of the whole airway passage.[44]

Carrier status can be determined by performing enzymatic assays in high-risk individuals.

Prenatal diagnosis for most of these disorders is available to high-risk mothers, such as mothers of an affected offspring, who face a 25% chance of having another affected offspring in a subsequent pregnancy.

In mucopolysaccharidosis type III, flash visual evoked potentials and brainstem auditory evoked potentials are almost always normal; electroencephalography findings are often abnormal early in the disease.[45]

Patients who present with progressive noninflammatory joint involvement in the first decade of life, particularly with stiffness of the fingers and difficulty using the hands, should be screened for metabolic diseases, including mucopolysaccharidosis type I.[46] Mucopolysaccharidosis type I should be considered if patients with arthropathy lack the typical characteristics of inflammatory arthropathy.

Screening for vitreous abnormalities and maculopathy may be important in diagnosing, treating, and explaining visual loss in persons with Hunter syndrome.[47]

In all types of mucopolysaccharidosis, normal or slightly thickened skin shows metachromatic granules within the fibroblasts by using Giemsa or toluidine blue staining. These metachromatic granules are occasionally evident within keratinocytes and eccrine structures. The characteristic cutaneous pebbling in Hunter syndrome shows these granules within the dermal fibroblasts and extracellular metachromatic material between the collagen bundles. In all types of mucopolysaccharidosis, the cytoplasm of circulating lymphocytes also demonstrates these granules. Patients with Morquio syndrome show reduced activity of N -acetyl-galactosamine-6-sulfatase on fibroblast culture obtained from a skin biopsy sample.

No cure exists for mucopolysaccharidosis; current treatment is symptomatic and supportive. However, possible treatments are being investigated in several clinical trials.

Current therapies

In patients with mucopolysaccharidosis type I, treatment with recombinant human alpha-L-iduronidase reduces lysosomal storage in the liver and ameliorates some clinical manifestations of the disease.[48]

In patients with mucopolysaccharidosis type I, laronidase significantly improves respiratory function and physical capacity, reduces GAG storage, and has a favorable safety profile.

A Hurler syndrome fibroblast cell line heterozygous for the IDUA gene that encodes alpha-L-iduronidase stop mutations Q70X or W402X shows a significant increase in alpha-L-iduronidase activity when cultured in the presence of gentamicin, resulting in the restoration of 2.8% of the normal alpha-L-iduronidase activity.

Allogeneic bone marrow transplantation (BMT) is the only long-lasting treatment that ameliorates or halts the aggressive course of the disease. Pulmonary hemorrhage is an unusual complication of BMT.[49]

Allogeneic hematopoietic SCT, used in severe forms of the disease, markedly prolongs survival, alleviates ventricular hypertrophy, and preserves cardiac function, but cardiac valves continue to thicken and valvular insufficiency progresses.[50]

Cell therapy with human amniotic epithelial cells was developed as an alternative method for enzyme replacement therapy in congenital lysosomal storage disorders, but only limited therapeutic efficacy has been reported. Some studies suggest that the transplantation of human amniotic epithelial cells transduced with adenoviral vectors can be used for the treatment of congenital lysosomal storage disorders. The multiple positive effects include reconstruction of the CNS.

Neonatal screening of these diseases should be mandatory to vastly improve outcomes. Plans are being implemented to use dried blood spots on filter paper, as is commonly performed for many other genetic diseases. Many new therapies are being adopted, which should enhance positivity and acceptance of treatment by hematopoietic SCT.

Many children who undergo SCT have deterioration in hearing following SCT. A high-risk group of children can be delineated who may benefit from more intensive audiologic monitoring following SCT.

For Maroteaux-Lamy syndrome, BMT is the only definitive form of enzyme replacement therapy available. Umbilical cord blood transplantation has also been reported as a treatment of this syndrome.

Yasuda et al report a case report with long-term observation after hematopoietic stem cells transplantation (HSCT) in a patient with mucopolysaccharidosis type I (Hurler syndrome). HSCT at an early stage of mucopolysaccharidosis type I (Hurler syndrome) provides a marked positive impact on clinical central nervous system and skeletal manifestations, bone pathology, and GAG levels. Thus, HSCT should be a primary standard care of mucopolysaccharidosis type I (Hurler syndrome) at an early stage.[51]

Therapy with glucocorticoids, high doses of vitamin A, thyroid hormone, lidase, and growth hormone has been attempted. Glucocorticoids and a corticotropin have been used to block the synthesis of acid mucopolysaccharides. High doses of vitamin A have been used in an effort to increase the urinary excretion of mucopolysaccharides; however, the amount excreted and the clinical response have varied. Lidase is a hyaluronidase that digests mucopolysaccharides. Thyroid hormone substitution is used in patients with hypothyroidism. Some patients with mucopolysaccharidosis are shown to have growth hormone deficiency, and in these cases, growth hormone therapy may be beneficial. Symptomatic anticonvulsive therapy is indicated when epilepsy is present. The prognosis is better and therapy is more successful when treatment is started early.

Treatment with recombinant human N -acetylgalactosamine 4-sulfatase (rhASB) is another possibility in mucopolysaccharidosis type VI. rhASB treatment reportedly was well-tolerated, and reduced lysosomal storage is evidenced by a dose-dependent reduction in urinary GAG.[52]

Flavonoids, as compounds related to genistein (an inhibitor of glycosaminoglycans [GAG] synthesis), are natural candidates for drugs that could be used to manage the neurological symptoms of mucopolysaccharidosis.

Kloska et al have tested the effects of 4 different flavonoids in assays for GAG synthesis, lysosomal structures, and phosphorylation of epidermal growth factor receptor. Skin fibroblasts obtained from mucopolysaccharidosis type IIIA and mucopolysaccharidosis type IIIB patients were used in all experiments, and a human dermal fibroblasts adult cell line was used as a healthy control line. Their studies revealed that apigenin (a flavone), daidzein (an isoflavone), kaempferol (a flavonol), and naringenin (a flavanone) caused a decrease in the efficiency of GAG synthesis, although only daidzein and kaempferol caused statistically significant differences relative to untreated cells. Nevertheless, in the presence of all these compounds, lysosomal storage in mucopolysaccharidosis type IIIA fibroblasts was significantly decreased. Flavonoids can be considered as potential drugs. Obviously, further tests, including those with animal models, are necessary to prove their safety for organisms.[53]

Treatments in clinical trials

No cure exists for mucopolysaccharidosis; treatment is symptomatic and supportive. However, possible treatments are being investigated in several clinical trials.

Mucopolysaccharidosis type I

Laronidase (Aldurazyme) is an enzyme replacement therapy for patients with mucopolysaccharidosis type I, a progressive, debilitating, and fatal genetic disease for which specific drug treatments currently are available. In a press release in September 2002, BioMarin and Genzyme included clinical data from the 6-month, placebo-controlled, phase 3 trial of laronidase; 6 months of data from the ongoing open-label, phase 3 extension study; and 3 years of data from the phase 1 trial and extension study. Laronidase was approved in the United States in April 2003.

The study of a double-blinded, placebo-controlled trial reported by Muenzer et al supports the use of weekly infusions of idursulfase in the treatment of mucopolysaccharidosis type II.[54] Idursulfase was generally well tolerated, but infusion reactions did occur. Idursulfase antibodies were detected in 46.9% of patients.[55, 56]

Mucopolysaccharidosis type II

In a press release from October 2002, Transkaryotic Therapies Inc (TKT) reported results from a phase 1/2 study evaluating its investigational enzyme replacement therapy with I2S as a treatment of Hunter syndrome. The randomized, double-blinded, placebo-controlled study evaluated the safety of I2S (human I2S produced by genetic engineering technology) and its clinical activity in 12 patients with Hunter syndrome. Three doses were studied (0.15 mg/kg, 0.5 mg/kg, and 1.5 mg/kg), and within each dose group, 3 patients were randomized to receive I2S and 1 was to receive placebo by a 60-min intravenous infusion biweekly for 6 months.

In the trial, I2S administration was generally well tolerated, and in the phase 1/2 trials, evidence of clinical activity with Hunter syndrome, including reduced cardiac mass, stabilized pulmonary function, and reduced GAG levels, was demonstrated. The most common adverse effects from I2S treatment were hives, chills, fever, and facial flushing. Only 1 of the 9 patients who were treated developed antibody to I2S.

Mucopolysaccharidosis type IVA

Elosulfase alfa (Vimizim; BioMarin Pharmaceutical, Inc.) was approved by the FDA in February 2014 for patients with Morquio A syndrome (mucopolysaccharidosis Type IVA [MPS IVA]). Approval was supported by a 24-week, randomized, clinical trial involving 176 patients. The primary endpoint of the trial, change in 6-minute walk distance at 24 weeks, was statistically significant in patients who received weekly elosulfase alfa 2 mg/kg IV infusions. The walking distance improved in the elosulfase alfa group with a mean increase of 22.5 meters over placebo. Walking ability was sustained in patients who continued weekly elosulfase alfa for an additional 48 weeks.[57]

Mucopolysaccharidosis type VI

The clinical trial of rhASB (Aryplase), an investigational enzyme replacement therapy for mucopolysaccharidosis type VI, continues to evaluate the efficacy, safety, and pharmacokinetics of weekly intravenous infusions of 1 mg/kg of rhASB in 10 patients with mucopolysaccharidosis type VI. In June 2002, BioMarin Pharmaceutical announced findings from the 24-week open-label extension of the phase 1 clinical trial; the enzyme was well tolerated by all patients, and reduced urinary excretion of GAG was maintained in both treatment arms.[58]

It was confirmed in the phase 3 of the randomized, double-blinded, placebo-controlled, multicenter, multinational study that rhASB significantly improves endurance, reduces urinary GAG excretion, and has an acceptable safety profile. After 24 weeks, patients receiving rhASB walked on average 92 meter more in the 12-minute walk test and climbed 5.7 stairs per minute more in a 3-minute stair climb test than patients receiving placebo. Urinary GAG declined by -227 ±18 mcg/mg more with rhASB than placebo. Patients exposed to the drug experienced positive clinical benefits despite the presence of antibody to the protein.

Mucopolysaccharidosis type VII

Emil Kakkis, MD, PhD, and William Sly, MD, have received a grant to develop enzyme replacement for mucopolysaccharidosis type VII. They are making steady progress with BioMarin Pharmaceutical, but no timeline for human clinical trials is projected.

Updated clinical trial data and recruiting

For updated clinical trial results and for trials that are completed and recruiting see ClinicalTrials.gov.

Treatment is symptomatic. Orthopedic surgeries may be required for mucopolysaccharidosis types I, II, IV, VI, and VII to correct the deformities and increase patient quality of life. Tonsillectomy and adenoidectomy may help improve the patients’ respiratory status. Other complications can be managed with myringotomy, heart-valve replacement, and decompression of the cervical spinal cord.[59]

Surgical procedures may include corneal transplantation and correction of nerve entrapments in the hands.

Correction of the contractures and osteal deformities may be performed. For patients with mucopolysaccharidosis type IV, cervical myelopathy should be prevented by surgery of the cervical spine.

Occipital to C3 decompression and fusion with autogenous rib grafts may be performed. The youngest patient who underwent this successful posterior cervical arthrodesis was 17-month-old boy with Sly syndrome.

Genetic counseling is of great importance to ensure prenatal diagnosis.

Mucopolysaccharidoses create a special challenge for the otolaryngologist. With the rare types of mucopolysaccharidosis type IV and mucopolysaccharidosis type I-S, a skilled practitioner is required to manage airway complications. The erratic deposits of mucopolysaccharides throughout the trachea should be taken into account when a decision is made to stent the airway. Proper management requires an airway that is custom made to meet the patient's needs.

Mucopolysaccharidosis type I (Hurler syndrome)

Complications include heart valve damage from thickening due to coronary artery disease, severe mental retardation, umbilical and inguinal hernia, deafness, premature death, and constipation alternating with diarrhea.

Mucopolysaccharidosis type II (Hunter syndrome)

Complications include airway obstruction in the late-onset form, progressive mental deterioration in the early-onset form (severe form), progressive loss of ability to perform daily living activities in the early-onset form (severe form), progressive hearing loss in both the mild and severe forms, progressive joint stiffness leading to contractures of the joints in the early-onset form (severe form), and carpal tunnel syndrome. Of the complications observed after tracheotomy, infrastomal tracheal stenosis and stomal narrowing are frequent. Intubation in children with mucopolysaccharidosis type II is more difficult (20 times more) than in other children of a similar age or weight.[60]

Mucopolysaccharidosis type III (Sanfilippo syndrome)

Complications include blindness, seizures, mental retardation, progressive neurologic disease leading to patients becoming wheelchair bound, and the inability to care for oneself.

Mucopolysaccharidosis type IV (Morquio syndrome)

Complications include heart failure, difficulty with vision, walking problems due to abnormal curvature of the spine, and breathing problems. Abnormal neck bones can cause spinal cord damage that can result in severe disease, including paralysis, if not noticed early. Spinal fusion can prevent this complication.

Mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome)

Complications include hearing loss, vision loss, carpal tunnel syndrome, and valvular heart disease.

Genetic counseling may be performed.

Prenatal diagnosis is possible. Amniocentesis can be performed; cells in the amniotic fluid are cultured, and the alpha-L-iduronidase activity in the cells is determined.

As determined by Altarescu et al, preimplantation genetic diagnosis (PGD) is a reliable method to prevent pregnancies of children affected with Hunter syndrome. In addition, they report the first ever derivation of a Hunter syndrome (46,XX) human stem cell line from embryos carrying the iduronate-2-sulfatase and oculocutaneous albinism type 2 mutations. PGD is a technique that precludes the need for pregnancy termination in cases of an affected fetus, by virtue of analysis of the 6- to 8-cell stage embryos (obtained by in vitro fertilization) and transfer of only unaffected embryos.[61]

All patients with mucopolysaccharidosis type I should receive a comprehensive baseline evaluation, including neurologic, ophthalmologic, auditory, cardiac, respiratory, gastrointestinal, and musculoskeletal assessments. Additionally, all patients should be monitored every 6-12 months with individualized specialty assessments, to monitor disease progression and effects of intervention. Patients are best treated by a multidisciplinary team. Treatments consist of palliative/supportive care, hematopoietic stem cell transplantation, and enzyme replacement therapy. The patient's age (>2 y or 2 y), predicted phenotype, and developmental quotient help define the risk-to-benefit profile for hematopoietic SCT transplantation (higher risk but can preserve CNS function) versus enzyme replacement therapy (low risk but cannot cross the blood-brain barrier).

International expert panels recommend the evaluation of ocular features at least every 12 months for patients with mucopolysaccharidosis type I and mucopolysaccharidosis type VI.[31]

MPS in Southern and Eastern European countries may be comparable, but issues limiting enzyme replacement therapy availability and reimbursement should be simplified to facilitate prompt initiation of treatment.[62]

N- acetylgalactosamine-4-sulfatase is a recombinant human enzyme used to treat mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome). Most attempts at enzyme replacement in various forms of mucopolysaccharidosis have not been successful. Alpha-L-iduronidase is a recombinant human enzyme used to treat mucopolysaccharidosis type I that received US patent approval in November 2001 and was approved in April 2003 as a proprietary product. Laronidase (Aldurazyme), present in cell lysosomes, helps to break down mucopolysaccharides. In mucopolysaccharidosis type I patients, mucopolysaccharides accumulate in organs and tissues, particularly in the CNS, the liver, the spleen, the heart, and the skeleton. This accumulation leads to cell death and progressive tissue and organ damage.[63]

Elosulfase alfa (Vimizim) was approved in February 2014 as an enzyme replacement for N -acetylgalactosamine-6 sulfatase (GALNS) deficiency in MPS IVA (Morquio A syndrome).

Class Summary

Enzyme replacement therapy may provide clinically important benefits (ie, improved pulmonary function and walking ability, reduced excess carbohydrates stored in organs).

Laronidase (Aldurazyme)

Laronidase is indicated to treat MPS type I (Hurler syndrome, Scheie syndrome, Hurler-Scheie syndrome). It is used to increase catabolism of GAGs, which accumulate with MPS type I. Treatment has been shown to improve walking capacity and pulmonary function. Laronidase is a polymorphic variant of the human enzyme alpha-L-iduronidase produced by recombinant DNA technology.

Idursulfase (Elaprase)

Idursulfase is a purified form of human I2S, a lysosomal enzyme. It hydrolyzes 2-sulfate esters of terminal iduronate sulfate residues from the GAGs dermatan sulfate and heparan sulfate in the lysosomes of various cell types. It is indicated for MPS type II (Hunter syndrome) because it replaces insufficient levels of the lysosomal enzyme I2S.

Elosulfase alfa (Vimizim)

Elosulfase alfa replaces deficient enzyme N-acetylgalactosamine-6 sulfatase (GALNS) to minimize progressive multisystemic manifestations of Morquio A syndrome. The enzyme is taken up into the lysosomes and increases catabolism of GAGs KS and C6S.

Vestronidase alfa-vjbk (Mepsevii)

Recombinant human lysosomal beta glucuronidase (GUS) is intended to provide exogenous GUS enzyme for uptake into cellular lysosome; mannose-6-phosphate (M6P) residues on the oligosaccharide chains allow binding of the enzyme to cell surface receptors, leading to cellular uptake of the enzyme, targeting to lysosomes, and subsequent catabolism of accumulated GAGs in affected tissues.